MITOWIKI - mitochondrial data sharing

  • Please take a moment to become familiar with the terms of use.
  • See this help page for info on posting content.
  • New pages are publicly viewable by default, but can only be changed by the author.


Enter a WikiWord:  


Most Recent Postings to MITOWIKI

What is MitoAge? The rapidly increasing number of species with fully sequenced mitochondrial DNA (mtDNA), together with accumulated data on longevity records, provide ...
F1 G HVI F CCCCCCCCGCGGCAGCGGGCGAGAGACTATGGGCCAATTTCTTTAACATTTTCGTTCTTTCTGGGGAAGAAAAAGGTACATAATATTGACTCCCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCCCCCCATGCTTACAAGCAAGTACACCAATCAACCTTCAACTATTACACATCAACTGCAACTTTAAAGCCCCCCCTCACCCCCTAGGATACCAACAAACCTACCCCCCCTTAACAATACATATTACATAAAGCCCTTTACCGTACATAGCACATTAAAGTCAAATCCCTTCTCGTCCCCATGGATAACCCCCCTCAAATAAGGGTCCCTTAACCACCACCCTCCCGGAAATCAATATCCCGCACAA ...
Western Blotting This Protocol starts where your SDS PAGE or Native Gel ends Transfer Buffer 4L (Store in a cold room) Trizma base 12.12g (0.303%) Glycine 57.6g ...
Protein Protocols WesternBlotting
Native Gel Protocols NativeGelProtocol1
Communication 2.0 Getting a group of people into the same physical domain solely for the purpose of exchanging ideas is inefficient and often prohibitive. Remote ...
Mitomaster Class Library API

You are here: MITOWIKI Web>WebHome
Topic revision: r12 - 29 Jan 2013 - 18:31:37 - MarieLott
 
Creative Commons License All site content, except where otherwise noted, is licensed under a Creative Commons Attribution 3.0 License.