MITOMAP: mtDNA Coding Region & RNA Sequence Variants

Last Edited: Jan 18, 2023

The GB frequency data is derived from 59389 GenBank sequences with size greater than 15.4kbp and 78884 Control Region sequences with size 0.4-1.6kbp. These sequences have been pre-loaded into Mitomaster and represent almost all haplogroups known to date. We will be updating and refining this set of sequences on a regular basis. As a caveat, please note that GenBank sequences may not be of equal quality (Yao, et al, 2009), that some of these sequences are from individuals with past, current or future disease, and that this portion of our data set has not been hand-curated by Mitomap.

For more details about the current GenBank sequence set, please see http://www.mitomap.org/MITOMAP/GBFreqInfo

Locus Nucleotide Position Nucleotide Change Codon number Codon Position Amino Acid Change GB frequency Curated References

577,"MT-TF","G-A","-","-","tRNA","0.000%","0","1"579,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"580,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"580,"MT-TF","T-del","-","-","tRNA","0.000%","0","1"581,"MT-TF","A-C","-","-","tRNA","0.000%","0","1"583,"MT-TF","G-T","-","-","tRNA","0.000%","0","1"584,"MT-TF","T-A","-","-","tRNA","0.000%","0","1"585,"MT-TF","A-AA","-","-","tRNA","0.000%","0","1"585,"MT-TF","A-G","-","-","tRNA","0.002%","1","1"588,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"588,"MT-TF","T-TCACAGTTTATGTAGCT","-","-","tRNA","0.000%","0","1"589,"MT-TF","T-del","-","-","tRNA","0.003%","2","1"589,"MT-TF","T-A","-","-","tRNA","0.000%","0","1"589,"MT-TF","T-TAGTTTATGTAGCTT","-","-","tRNA","0.000%","0","1"590,"MT-TF","A-AA","-","-","tRNA","0.002%","1","1"590,"MT-TF","A-ACACAGTTTATGTAGCTTA","-","-","tRNA","0.000%","0","1"590,"MT-TF","A-C","-","-","tRNA","0.000%","0","1"591,"MT-TF","C-A","-","-","tRNA","0.010%","6","1"591,"MT-TF","C-CCAGTTTATGTAGCTTAC","-","-","tRNA","0.000%","0","1"591,"MT-TF","C-T","-","-","tRNA","0.000%","0","1"592,"MT-TF","C-A","-","-","tRNA","0.003%","2","1"592,"MT-TF","C-CC","-","-","tRNA","0.000%","0","1"592,"MT-TF","C-T","-","-","tRNA","0.010%","6","4"593,"MT-TF","T-del","-","-","tRNA","0.005%","3","1"593,"MT-TF","T-A","-","-","tRNA","0.019%","11","2"593,"MT-TF","T-C","-","-","tRNA","0.470% ","279","17"593,"MT-TF","T-G","-","-","tRNA","0.003%","2","1"594,"MT-TF","C-A","-","-","tRNA","0.002%","1","1"594,"MT-TF","C-T","-","-","tRNA","0.008%","5","2"595,"MT-TF","C-A","-","-","tRNA","0.003%","2","2"595,"MT-TF","C-CA","-","-","tRNA","0.002%","1","1"595,"MT-TF","C-CC","-","-","tRNA","0.221% ","131","5"595,"MT-TF","C-T","-","-","tRNA","0.002%","1","3"596,"MT-TF","T-C","-","-","tRNA","0.030%","18","4"597,"MT-TF","C-CC","-","-","tRNA","0.003%","2","1"597,"MT-TF","C-CT","-","-","tRNA","0.040%","24","2"597,"MT-TF","C-T","-","-","tRNA","0.224%","133","5"598,"MT-TF","A-AT","-","-","tRNA","0.003%","2","1"598,"MT-TF","A-ATCA","-","-","tRNA","0.000%","0","1"600,"MT-TF","A-del","-","-","tRNA","0.000%","0","1"601,"MT-TF","G-A","-","-","tRNA","0.000%","0","1"603,"MT-TF","A-G","-","-","tRNA","0.005%","3","2"604,"MT-TF","A-G","-","-","tRNA","0.000%","0","1"604,"MT-TF","A-T","-","-","tRNA","0.003%","2","1"605,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"606,"MT-TF","A-G","-","-","tRNA","0.037%","22","3"606,"MT-TF","A-T","-","-","tRNA","0.000%","0","1"608,"MT-TF","A-G","-","-","tRNA","0.000%","0","1"608,"MT-TF","A-T","-","-","tRNA","0.000%","0","1"610,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"612,"MT-TF","A-G","-","-","tRNA","0.000%","0","1"614,"MT-TF","AA-del","-","-","tRNA","0.000%","0","1"614,"MT-TF","A-G","-","-","tRNA","0.019%","11","1"614,"MT-TF","A-T","-","-","tRNA","0.002%","1","1"616,"MT-TF","T-A","-","-","tRNA","0.000%","0","1"616,"MT-TF","T-G","-","-","tRNA","0.002%","1","1"618,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"619,"MT-TF","T-A","-","-","tRNA","0.000%","0","1"619,"MT-TF","T-C","-","-","tRNA","0.005%","3","1"620,"MT-TF","T-C","-","-","tRNA","0.000%","0","1"620,"MT-TF","T-TT","-","-","tRNA","0.000%","0","1"621,"MT-TF","A-G","-","-","tRNA","0.002%","1","2"622,"MT-TF","G-C","-","-","tRNA","0.002%","1","1"622,"MT-TF","G-A","-","-","tRNA","0.000%","0","1"624,"MT-TF","C-T","-","-","tRNA","0.000%","0","1"625,"MT-TF","G-T","-","-","tRNA","0.000%","0","1"627,"MT-TF","G-del","-","-","tRNA","0.000%","0","1"627,"MT-TF","G-A","-","-","tRNA","0.000%","0","1"628,"MT-TF","C-T","-","-","tRNA","0.000%","0","1"628,"MT-TF","C-A","-","-","tRNA","0.000%","0","1"629,"MT-TF","T-A","-","-","tRNA","0.000%","0","2"629,"MT-TF","T-C","-","-","tRNA","0.259% ","154","8"629,"MT-TF","T-G","-","-","tRNA","0.000%","0","1"630,"MT-TF","C-T","-","-","tRNA","0.020%","12","2"631,"MT-TF","A-AA","-","-","tRNA","0.000%","0","1"631,"MT-TF","A-G","-","-","tRNA","0.003%","2","1"632,"MT-TF","CA-del","-","-","tRNA","0.000%","0","1"632,"MT-TF","C-T","-","-","tRNA","0.012%","7","1"633,"MT-TF","A-G","-","-","tRNA","0.020%","12","4"633,"MT-TF","A-T","-","-","tRNA","0.003%","2","1"634,"MT-TF","T-A","-","-","tRNA","0.015%","9","3"634,"MT-TF","T-C","-","-","tRNA","0.054%","32","4"634,"MT-TF","T-G","-","-","tRNA","0.002%","1","1"635,"MT-TF","C-T","-","-","tRNA","0.010%","6","3"636,"MT-TF","A-C","-","-","tRNA","0.002%","1","1"636,"MT-TF","A-G","-","-","tRNA","0.034%","20","1"636,"MT-TF","A-T","-","-","tRNA","0.002%","1","1"643,"MT-TF","A-G","-","-","tRNA","0.000%","0","1"643,"MT-TF","A-T","-","-","tRNA","0.002%","1","1"644,"MT-TF","A-G","-","-","tRNA","0.047%","28","2"645,"MT-HSP2","A-AA","-","-","tRNA","0.002%","1","1"645,"MT-TF","A-AA","-","-","tRNA","0.002%","1","1"645,"MT-TF","A-G","-","-","tRNA","0.000%","0","1"645,"MT-HSP2","A-G","-","-","tRNA","0.000%","0","1"647,"MT-TF","A-G","-","-","tRNA","0.019%","11","3"648,"MT-RNR1","A-G","-","-","rRNA","0.008%","5","1"649,"MT-RNR1","A-AA","-","-","rRNA","0.002%","1","1"649,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"650,"MT-RNR1","T-C","-","-","rRNA","0.067%","40","2"650,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"652,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"653,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"653,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"654,"MT-RNR1","T-C","-","-","rRNA","0.025%","15","3"655,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"656,"MT-RNR1","T-C","-","-","rRNA","0.111%","66","2"656,"MT-RNR1","T-G","-","-","rRNA","0.002%","1","1"656,"MT-RNR1","T-TT","-","-","rRNA","0.002%","1","1"657,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"658,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"658,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"659,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"662,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"663,"MT-RNR1","A-G","-","-","rRNA","2.915% ","1731","47"664,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"664,"MT-RNR1","G-GT","-","-","rRNA","0.000%","0","1"668,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"669,"MT-RNR1","T-C","-","-","rRNA","0.182%","108","8"670,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"671,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"673,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"674,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"675,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"675,"MT-RNR1","A-G","-","-","rRNA","0.007%","4","1"676,"MT-RNR1","G-A","-","-","rRNA","0.039%","23","2"676,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"678,"MT-RNR1","T-C","-","-","rRNA","0.032%","19","1"679,"MT-RNR1","C-A","-","-","rRNA","0.003%","2","1"679,"MT-RNR1","C-T","-","-","rRNA","0.013%","8","1"680,"MT-RNR1","T-C","-","-","rRNA","0.263% ","156","7"681,"MT-RNR1","T-del","-","-","rRNA","0.000%","0","1"681,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"681,"MT-RNR1","T-C","-","-","rRNA","0.280% ","166","9"682,"MT-RNR1","A-T","-","-","rRNA","0.003%","2","1"683,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"683,"MT-RNR1","G-T","-","-","rRNA","0.003%","2","1"684,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"686,"MT-RNR1","A-G","-","-","rRNA","0.012%","7","1"688,"MT-RNR1","A-del","-","-","rRNA","0.002%","1","1"689,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"689,"MT-RNR1","T-C","-","-","rRNA","0.010%","6","2"689,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","2"690,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"692,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"695,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"699,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"700,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"702,"MT-RNR1","C-T","-","-","rRNA","0.015%","9","1"703,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"704,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"704,"MT-RNR1","T-G","-","-","rRNA","0.002%","1","1"705,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"706,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"706,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"707,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"708,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"708,"MT-RNR1","C-G","-","-","rRNA","0.000%","0","1"708,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"709,"MT-RNR1","G-A","-","-","rRNA","12.996% ","7718","112"709,"MT-RNR1","G-C","-","-","rRNA","0.002%","1","1"710,"MT-RNR1","T-A","-","-","rRNA","0.002%","1","1"710,"MT-RNR1","T-C","-","-","rRNA","0.658% ","391","11"711,"MT-RNR1","T-del","-","-","rRNA","0.000%","0","1"711,"MT-RNR1","T-C","-","-","rRNA","0.286%","170","6"711,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"711,"MT-RNR1","T-TT","-","-","rRNA","0.000%","0","1"712,"MT-RNR1","C-A","-","-","rRNA","0.012%","7","1"712,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"714,"MT-RNR1","A-G","-","-","rRNA","0.020%","12","1"714,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","2"715,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"717,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"718,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"718,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"719,"MT-RNR1","G-A","-","-","rRNA","0.928% ","551","3"720,"MT-RNR1","T-C","-","-","rRNA","0.012%","7","1"721,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"721,"MT-RNR1","T-C","-","-","rRNA","0.231%","137","9"722,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"722,"MT-RNR1","C-T","-","-","rRNA","0.150%","89","10"723,"MT-RNR1","A-C","-","-","rRNA","0.079%","47","7"723,"MT-RNR1","A-G","-","-","rRNA","0.281% ","167","5"723,"MT-RNR1","A-T","-","-","rRNA","0.015%","9","3"724,"MT-RNR1","C-G","-","-","rRNA","0.003%","2","1"725,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"726,"MT-RNR1","C-A","-","-","rRNA","0.003%","2","1"726,"MT-RNR1","C-CC","-","-","rRNA","0.000%","0","1"727,"MT-RNR1","T-C","-","-","rRNA","0.003%","2","1"728,"MT-RNR1","C-G","-","-","rRNA","0.003%","2","1"728,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"729,"MT-RNR1","T-C","-","-","rRNA","0.019%","11","1"730,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"731,"MT-RNR1","A-G","-","-","rRNA","0.056%","33","1"732,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","1"732,"MT-RNR1","A-G","-","-","rRNA","0.052%","31","1"733,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"734,"MT-RNR1","C-G","-","-","rRNA","0.003%","2","1"734,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"735,"MT-RNR1","A-AG","-","-","rRNA","0.002%","1","1"735,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"735,"MT-RNR1","A-G","-","-","rRNA","0.130%","77","2"736,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"736,"MT-RNR1","C-G","-","-","rRNA","0.003%","2","1"736,"MT-RNR1","C-T","-","-","rRNA","0.017%","10","3"737,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","2"738,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"738,"MT-RNR1","A-G","-","-","rRNA","0.008%","5","1"739,"MT-RNR1","C-T","-","-","rRNA","0.163%","97","3"740,"MT-RNR1","G-A","-","-","rRNA","0.056%","33","5"741,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"742,"MT-RNR1","T-A","-","-","rRNA","0.003%","2","1"742,"MT-RNR1","T-C","-","-","rRNA","0.032%","19","3"742,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"743,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"744,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"744,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"745,"MT-RNR1","A-AG","-","-","rRNA","0.000%","0","1"745,"MT-RNR1","A-AT","-","-","rRNA","0.066%","39","1"745,"MT-RNR1","A-G","-","-","rRNA","0.064%","38","7"746,"MT-RNR1","A-G","-","-","rRNA","0.005%","3","1"747,"MT-RNR1","A-AA","-","-","rRNA","0.002%","1","1"747,"MT-RNR1","A-G","-","-","rRNA","0.017%","10","1"748,"MT-RNR1","G-A","-","-","rRNA","0.013%","8","2"749,"MT-RNR1","G-A","-","-","rRNA","0.015%","9","1"750,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"750,"MT-RNR1","A-G","-","-","rRNA","98.271% ","58362","114"751,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"751,"MT-RNR1","A-G","-","-","rRNA","0.047%","28","4"751,"MT-RNR1","A-T","-","-","rRNA","0.010%","6","2"752,"MT-RNR1","C-A","-","-","rRNA","0.005%","3","1"752,"MT-RNR1","C-G","-","-","rRNA","0.003%","2","1"752,"MT-RNR1","C-T","-","-","rRNA","0.381% ","226","17"753,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"753,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"755,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","1"756,"MT-RNR1","C-T","-","-","rRNA","0.007%","4","1"759,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"759,"MT-RNR1","C-T","-","-","rRNA","0.010%","6","1"760,"MT-RNR1","A-AC","-","-","rRNA","0.002%","1","1"761,"MT-RNR1","A-G","-","-","rRNA","0.008%","5","3"762,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"764,"MT-RNR1","A-G","-","-","rRNA","0.012%","7","1"765,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"766,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"768,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"769,"MT-RNR1","G-A","-","-","rRNA","7.288% ","4328","27"770,"MT-RNR1","C-T","-","-","rRNA","0.035%","21","3"770,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"771,"MT-RNR1","A-G","-","-","rRNA","0.010%","6","1"771,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"772,"MT-RNR1","A-G","-","-","rRNA","0.005%","3","1"772,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"775,"MT-RNR1","C-T","-","-","rRNA","0.010%","6","1"776,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"777,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"779,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"780,"MT-RNR1","C-CC","-","-","rRNA","0.002%","1","1"782,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"783,"MT-RNR1","A-G","-","-","rRNA","0.042%","25","1"784,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","2"786,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"787,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"788,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"789,"MT-RNR1","T-A","-","-","rRNA","0.020%","12","1"789,"MT-RNR1","T-C","-","-","rRNA","0.148%","88","7"792,"MT-RNR1","C-CT","-","-","rRNA","0.000%","0","1"792,"MT-RNR1","C-T","-","-","rRNA","0.008%","5","1"793,"MT-RNR1","C-G","-","-","rRNA","0.002%","1","1"793,"MT-RNR1","C-T","-","-","rRNA","0.030%","18","4"794,"MT-RNR1","T-A","-","-","rRNA","0.101%","60","3"794,"MT-RNR1","T-C","-","-","rRNA","0.069%","41","6"794,"MT-RNR1","T-TT","-","-","rRNA","0.000%","0","1"795,"MT-RNR1","A-G","-","-","rRNA","0.005%","3","1"795,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"796,"MT-RNR1","G-A","-","-","rRNA","0.012%","7","1"797,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"799,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"800,"MT-RNR1","C-CC","-","-","rRNA","0.000%","0","1"800,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"801,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"801,"MT-RNR1","A-G","-","-","rRNA","0.012%","7","0"804,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"806,"MT-RNR1","C-del","-","-","rRNA","0.002%","1","1"806,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"808,"MT-RNR1","C-T","-","-","rRNA","0.017%","10","1"809,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"811,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","1"812,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"813,"MT-RNR1","A-G","-","-","rRNA","0.382% ","227","9"813,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"814,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","4"817,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"820,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"822,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"823,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"824,"MT-RNR1","T-C","-","-","rRNA","0.088%","52","4"825,"MT-RNR1","T-A","-","-","rRNA","4.531% ","2691","16"825,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"826,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"827,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"827,"MT-RNR1","A-G","-","-","rRNA","2.657% ","1578","24"828,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"829,"MT-RNR1","C-CC","-","-","rRNA","0.002%","1","1"829,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"834,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"835,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"836,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"839,"MT-RNR1","A-G","-","-","rRNA","0.012%","7","0"841,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"845,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"847,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"849,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"850,"MT-RNR1","T-del","-","-","rRNA","0.000%","0","1"850,"MT-RNR1","T-C","-","-","rRNA","0.205% ","122","3"851,"MT-RNR1","A-G","-","-","rRNA","0.054%","32","4"851,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"852,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"854,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"855,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"856,"MT-RNR1","A-G","-","-","rRNA","0.030%","18","5"857,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","2"858,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"859,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"861,"MT-RNR1","T-C","-","-","rRNA","0.003%","2","1"862,"MT-RNR1","A-G","-","-","rRNA","0.035%","21","1"865,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"866,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","2"866,"MT-RNR1","A-G","-","-","rRNA","0.019%","11","1"867,"MT-RNR1","C-T","-","-","rRNA","0.019%","11","1"868,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"868,"MT-RNR1","C-T","-","-","rRNA","0.042%","25","2"869,"MT-RNR1","C-A","-","-","rRNA","0.003%","2","1"869,"MT-RNR1","C-G","-","-","rRNA","0.000%","0","1"869,"MT-RNR1","C-T","-","-","rRNA","0.126%","75","4"870,"MT-RNR1","C-del","-","-","rRNA","0.000%","0","2"870,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"870,"MT-RNR1","C-T","-","-","rRNA","0.123%","73","5"873,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"874,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"874,"MT-RNR1","G-GG","-","-","rRNA","0.000%","0","1"879,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"883,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"884,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"887,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"893,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"894,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"895,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"895,"MT-RNR1","C-G","-","-","rRNA","0.002%","1","1"895,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"896,"MT-RNR1","A-G","-","-","rRNA","0.093%","55","3"897,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","2"899,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"904,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"906,"MT-RNR1","C-T","-","-","rRNA","0.010%","6","1"913,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"914,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"914,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"918,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"920,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"921,"MT-RNR1","T-C","-","-","rRNA","0.722% ","429","15"922,"MT-RNR1","C-A","-","-","rRNA","0.005%","3","1"922,"MT-RNR1","C-G","-","-","rRNA","0.000%","0","1"922,"MT-RNR1","C-T","-","-","rRNA","0.008%","5","2"925,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"926,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"928,"MT-RNR1","A-G","-","-","rRNA","0.034%","20","1"929,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"929,"MT-RNR1","A-T","-","-","rRNA","0.005%","3","1"930,"MT-RNR1","G-A","-","-","rRNA","2.090% ","1241","29"930,"MT-RNR1","G-C","-","-","rRNA","0.114%","68","2"930,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"931,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"931,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"934,"MT-RNR1","G-C","-","-","rRNA","0.002%","1","1"935,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"939,"MT-RNR1","AA-del","-","-","rRNA","0.000%","0","1"939,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"939,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"941,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"942,"MT-RNR1","A-G","-","-","rRNA","0.072%","43","3"943,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"945,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"945,"MT-RNR1","G-T","-","-","rRNA","0.000%","0","1"950,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"951,"MT-RNR1","G-A","-","-","rRNA","0.726% ","431","22"952,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"953,"MT-RNR1","T-C","-","-","rRNA","0.019%","11","5"954,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCCCCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCCCCCCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-CCCCCCCCCCCCCC","-","-","rRNA","0.000%","0","1"954,"MT-RNR1","C-T","-","-","rRNA","0.037%","22","2"955,"MT-RNR1","A-del","-","-","rRNA","0.003%","2","1"955,"MT-RNR1","A-AACCC","-","-","rRNA","0.000%","0","1"955,"MT-RNR1","A-ACA","-","-","rRNA","0.000%","0","1"955,"MT-RNR1","A-ACACC","-","-","rRNA","0.000%","0","1"955,"MT-RNR1","A-AM","-","-","rRNA","0.000%","0","1"955,"MT-RNR1","A-C","-","-","rRNA","0.005%","3","1"955,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","3"955,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"956,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"956,"MT-RNR1","C-T","-","-","rRNA","0.020%","12","1"957,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"957,"MT-RNR1","C-T","-","-","rRNA","0.069%","41","1"958,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"958,"MT-RNR1","C-T","-","-","rRNA","0.029%","17","3"959,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"959,"MT-RNR1","C-T","-","-","rRNA","0.040%","24","3"960,"MT-RNR1","C-del","-","-","rRNA","0.000%","0","6"960,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"960,"MT-RNR1","C-CC","-","-","rRNA","0.647% ","384","19"960,"MT-RNR1","C-CCC","-","-","rRNA","0.000%","0","2"960,"MT-RNR1","C-CCCC","-","-","rRNA","0.044%","26","1"960,"MT-RNR1","C-CCCCC","-","-","rRNA","0.013%","8","1"960,"MT-RNR1","C-CCCCCC","-","-","rRNA","0.005%","3","1"960,"MT-RNR1","C-CCCCCCC","-","-","rRNA","0.003%","2","1"960,"MT-RNR1","C-CCCCCCCC","-","-","rRNA","0.000%","0","1"960,"MT-RNR1","C-CCCCCCCCCCCCC","-","-","rRNA","0.000%","0","1"960,"MT-RNR1","C-CCCCCCCCCCCCCC","-","-","rRNA","0.000%","0","1"960,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"960,"MT-RNR1","CT-del","-","-","rRNA","0.002%","1","1"961,"MT-RNR1","T-del","-","-","rRNA","0.003%","2","4"961,"MT-RNR1","T-A","-","-","rRNA","0.005%","3","3"961,"MT-RNR1","T-C","-","-","rRNA","0.913% ","542","20"961,"MT-RNR1","T-G","-","-","rRNA","0.362% ","215","18"962,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"962,"MT-RNR1","C-G","-","-","rRNA","0.000%","0","1"962,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"963,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"963,"MT-RNR1","C-T","-","-","rRNA","0.012%","7","1"964,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","2"964,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"965,"MT-RNR1","C-del","-","-","rRNA","0.000%","0","2"965,"MT-RNR1","C-CC","-","-","rRNA","0.002%","1","1"965,"MT-RNR1","C-CCCC","-","-","rRNA","0.000%","0","1"965,"MT-RNR1","C-CCCCCC","-","-","rRNA","0.000%","0","1"965,"MT-RNR1","C-CCN","-","-","see also 955insCC+","0.003%","2","1"965,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"966,"MT-RNR1","A-AC","-","-","rRNA","0.002%","1","1"966,"MT-RNR1","A-ACC","-","-","rRNA","0.002%","1","1"966,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"969,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"971,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"974,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"977,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"978,"MT-RNR1","A-G","-","-","rRNA","0.015%","9","2"979,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"979,"MT-RNR1","C-T","-","-","rRNA","0.108%","64","2"980,"MT-RNR1","T-C","-","-","rRNA","0.982% ","583","13"980,"MT-RNR1","T-G","-","-","rRNA","0.002%","1","1"981,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"982,"MT-RNR1","A-G","-","-","rRNA","0.005%","3","1"983,"MT-RNR1","C-T","-","-","rRNA","0.022%","13","2"984,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"985,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"986,"MT-RNR1","G-A","-","-","rRNA","0.017%","10","1"986,"MT-RNR1","G-C","-","-","rRNA","0.005%","3","1"986,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"987,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"987,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"988,"MT-RNR1","G-A","-","-","rRNA","0.079%","47","7"988,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"989,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"989,"MT-RNR1","T-C","-","-","rRNA","0.007%","4","1"990,"MT-RNR1","T-C","-","-","rRNA","0.061%","36","1"992,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"994,"MT-RNR1","A-G","-","-","rRNA","0.005%","3","1"996,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"997,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"998,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","2"998,"MT-RNR1","A-G","-","-","rRNA","0.045%","27","1"999,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"1000,"MT-RNR1","T-A","-","-","rRNA","0.002%","1","1"1000,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1000,"MT-RNR1","T-G","-","-","rRNA","0.005%","3","1"1001,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1001,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1002,"MT-RNR1","C-T","-","-","rRNA","0.020%","12","2"1005,"MT-RNR1","T-C","-","-","rRNA","0.443% ","263","14"1005,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"1006,"MT-RNR1","T-A","-","-","rRNA","0.002%","1","1"1006,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1007,"MT-RNR1","G-A","-","-","rRNA","0.133%","79","5"1007,"MT-RNR1","G-C","-","-","rRNA","0.002%","1","1"1008,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"1008,"MT-RNR1","A-G","-","-","rRNA","0.059%","35","4"1008,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1009,"MT-RNR1","C-T","-","-","rRNA","0.128%","76","3"1011,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1011,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1013,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1014,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"1016,"MT-RNR1","T-C","-","-","rRNA","0.005%","3","1"1018,"MT-RNR1","G-A","-","-","rRNA","7.357% ","4369","22"1019,"MT-RNR1","A-G","-","-","rRNA","0.039%","23","1"1021,"MT-RNR1","T-A","-","-","rRNA","0.002%","1","1"1021,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1024,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1027,"MT-RNR1","A-G","-","-","rRNA","0.029%","17","1"1029,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1030,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1031,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","1"1032,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1033,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1037,"MT-RNR1","A-G","-","-","rRNA","0.005%","3","1"1038,"MT-RNR1","C-G","-","-","rRNA","0.000%","0","1"1038,"MT-RNR1","C-T","-","-","rRNA","0.019%","11","1"1039,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"1039,"MT-RNR1","A-G","-","-","rRNA","0.077%","46","1"1040,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"1040,"MT-RNR1","T-C","-","-","rRNA","0.328% ","195","3"1041,"MT-RNR1","A-G","-","-","rRNA","0.514% ","305","13"1042,"MT-RNR1","T-A","-","-","rRNA","0.002%","1","1"1042,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1044,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1047,"MT-RNR1","A-G","-","-","rRNA","0.067%","40","4"1048,"MT-RNR1","C-T","-","-","rRNA","3.214% ","1909","18"1050,"MT-RNR1","C-G","-","-","rRNA","0.002%","1","1"1051,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1053,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"1053,"MT-RNR1","A-G","-","-","rRNA","0.025%","15","1"1053,"MT-RNR1","A-T","-","-","rRNA","0.003%","2","1"1054,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1055,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"1055,"MT-RNR1","T-C","-","-","rRNA","0.003%","2","1"1055,"MT-RNR1","T-G","-","-","rRNA","0.002%","1","1"1059,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1061,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1061,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1063,"MT-RNR1","A-G","-","-","rRNA","0.007%","4","1"1064,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1065,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1079,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1081,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1081,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"1082,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1084,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1089,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1092,"MT-RNR1","G-C","-","-","rRNA","0.002%","1","1"1094,"MT-RNR1","T-C","-","-","rRNA","0.007%","4","1"1095,"MT-RNR1","T-C","-","-","rRNA","0.109%","65","4"1096,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"1097,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1100,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"1104,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1106,"MT-RNR1","C-T","-","-","rRNA","0.064%","38","2"1107,"MT-RNR1","T-C","-","-","rRNA","0.699% ","415","17"1110,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1113,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1115,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1116,"MT-RNR1","A-G","-","-","rRNA","0.019%","11","1"1117,"MT-RNR1","A-G","-","-","rRNA","0.057%","34","4"1118,"MT-RNR1","A-G","-","-","rRNA","0.013%","8","1"1118,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"1119,"MT-RNR1","T-A","-","-","rRNA","0.000%","0","1"1119,"MT-RNR1","T-C","-","-","rRNA","0.527% ","313","12"1120,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1120,"MT-RNR1","C-T","-","-","rRNA","0.049%","29","2"1121,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1122,"MT-RNR1","A-AA","-","-","rRNA","0.002%","1","1"1123,"MT-RNR1","C-CCA","-","-","rRNA","0.002%","1","1"1125,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1126,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1127,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1127,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1129,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1130,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1133,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1135,"MT-RNR1","C-G","-","-","rRNA","0.002%","1","1"1138,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1140,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","1"1140,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1140,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"1141,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1142,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1143,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"1144,"MT-RNR1","T-G","-","-","rRNA","0.003%","2","1"1147,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1147,"MT-RNR1","G-T","-","-","rRNA","0.000%","0","1"1148,"MT-RNR1","A-G","-","-","rRNA","0.007%","4","2"1149,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1151,"MT-RNR1","C-T","-","-","rRNA","0.007%","4","1"1152,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1153,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1154,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","2"1154,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1154,"MT-RNR1","A-T","-","-","rRNA","0.034%","20","1"1160,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1161,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1162,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1163,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1168,"MT-RNR1","A-del","-","-","rRNA","0.002%","1","1"1168,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1168,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1170,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1171,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1173,"MT-RNR1","C-T","-","-","rRNA","0.008%","5","1"1174,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1179,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1181,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1182,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1183,"MT-RNR1","T-C","-","-","rRNA","0.007%","4","1"1184,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1185,"MT-RNR1","C-T","-","-","rRNA","0.086%","51","4"1186,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"1187,"MT-RNR1","T-C","-","-","rRNA","0.094%","56","4"1189,"MT-RNR1","T-C","-","-","rRNA","3.110% ","1847","24"1190,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1192,"MT-RNR1","C-A","-","-","rRNA","0.015%","9","1"1192,"MT-RNR1","C-T","-","-","rRNA","0.025%","15","0"1193,"MT-RNR1","T-C","-","-","rRNA","0.296% ","176","9"1193,"MT-RNR1","T-G","-","-","rRNA","0.002%","1","1"1197,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1197,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"1198,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1199,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1199,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"1200,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1201,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1207,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"1210,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1211,"MT-RNR1","G-A","-","-","rRNA","0.125%","74","6"1214,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1215,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1216,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1219,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","2"1220,"MT-RNR1","A-ACTACCTGACCGGCGAGACATTCCAGCTCCCCGCCGTCACCATCACAGCCAC","-","-","rRNA","0.000%","0","1"1221,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1222,"MT-RNR1","A-del","-","-","rRNA","0.002%","1","1"1222,"MT-RNR1","A-G","-","-","rRNA","0.052%","31","1"1226,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1227,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1227,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1230,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1231,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1231,"MT-RNR1","A-T","-","-","rRNA","0.003%","2","1"1233,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1235,"MT-RNR1","T-C","-","-","rRNA","0.008%","5","1"1236,"MT-RNR1","C-T","-","-","rRNA","0.032%","19","1"1237,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1240,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1241,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1242,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"1243,"MT-RNR1","T-C","-","-","rRNA","1.615% ","959","17"1244,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1246,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1247,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1249,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1250,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"1255,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1256,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1257,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1263,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1263,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1266,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1267,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1270,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1275,"MT-RNR1","A-C","-","-","rRNA","0.003%","2","1"1275,"MT-RNR1","A-G","-","-","rRNA","0.015%","9","1"1275,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1276,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1277,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1278,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1282,"MT-RNR1","G-A","-","-","rRNA","0.015%","9","1"1283,"MT-RNR1","A-del","-","-","rRNA","0.002%","1","1"1284,"MT-RNR1","T-C","-","-","rRNA","0.061%","36","2"1287,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1288,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1289,"MT-RNR1","G-A","-","-","rRNA","0.005%","3","1"1290,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1290,"MT-RNR1","C-T","-","-","rRNA","0.040%","24","4"1291,"MT-RNR1","T-A","-","-","rRNA","0.005%","3","1"1291,"MT-RNR1","T-C","-","-","rRNA","0.093%","55","3"1292,"MT-RNR1","A-G","-","-","rRNA","0.034%","20","1"1293,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1294,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1296,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","1"1297,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1299,"MT-RNR1","A-G","-","-","rRNA","0.015%","9","2"1299,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1300,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1303,"MT-RNR1","G-A","-","-","rRNA","0.131%","78","6"1304,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1306,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1307,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","1"1307,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1308,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1309,"MT-RNR1","A-G","-","-","rRNA","0.010%","6","3"1310,"MT-RNR1","C-T","-","-","rRNA","0.066%","39","11"1312,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1313,"MT-RNR1","A-C","-","-","rRNA","0.007%","4","1"1313,"MT-RNR1","A-G","-","-","rRNA","0.051%","30","1"1313,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1315,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","1"1316,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1317,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1318,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1319,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1320,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1323,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1324,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1326,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1328,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1330,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1331,"MT-RNR1","A-G","-","-","rRNA","0.017%","10","1"1334,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1335,"MT-RNR1","T-del","-","-","rRNA","0.002%","1","1"1336,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1337,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1339,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1341,"MT-RNR1","C-T","-","-","rRNA","0.059%","35","5"1342,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1342,"MT-RNR1","C-T","-","-","rRNA","0.057%","34","4"1344,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1344,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"1345,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1346,"MT-RNR1","A-G","-","-","rRNA","0.019%","11","1"1347,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1348,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1349,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1352,"MT-RNR1","C-A","-","-","rRNA","0.017%","10","1"1352,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"1353,"MT-RNR1","A-T","-","-","rRNA","0.002%","1","1"1354,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1355,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1356,"MT-RNR1","A-T","-","-","rRNA","0.003%","2","1"1358,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1359,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"1362,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1364,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1368,"MT-RNR1","T-C","-","-","rRNA","0.005%","3","1"1370,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1371,"MT-RNR1","T-TT","-","-","rRNA","0.002%","1","1"1372,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1373,"MT-RNR1","T-C","-","-","rRNA","0.003%","2","1"1374,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1374,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1374,"MT-RNR1","A-T","-","-","rRNA","0.005%","3","1"1375,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"1375,"MT-RNR1","C-T","-","-","rRNA","0.030%","18","2"1376,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1377,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"1377,"MT-RNR1","C-G","-","-","rRNA","0.002%","1","1"1377,"MT-RNR1","C-T","-","-","rRNA","0.010%","6","1"1378,"MT-RNR1","C-CC","-","-","rRNA","0.002%","1","1"1380,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1382,"MT-RNR1","A-C","-","-","rRNA","0.327% ","194","20"1383,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1383,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1383,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1384,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1385,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1386,"MT-RNR1","T-C","-","-","rRNA","0.074%","44","1"1389,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","2"1389,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"1390,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1391,"MT-RNR1","T-C","-","-","rRNA","0.210% ","125","7"1392,"MT-RNR1","A-del","-","-","rRNA","0.002%","1","1"1392,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1393,"MT-RNR1","G-A","-","-","rRNA","0.195%","116","7"1394,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1395,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1396,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"1397,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1398,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1398,"MT-RNR1","T-TT","-","-","rRNA","0.002%","1","1"1400,"MT-RNR1","T-TT","-","-","rRNA","0.002%","1","1"1402,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1404,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1405,"MT-RNR1","C-T","-","-","rRNA","0.007%","4","1"1406,"MT-RNR1","T-C","-","-","rRNA","0.310% ","184","12"1407,"MT-RNR1","T-A","-","-","rRNA","0.015%","9","1"1407,"MT-RNR1","T-C","-","-","rRNA","0.003%","2","2"1408,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1409,"MT-RNR1","A-del","-","-","rRNA","0.000%","0","2"1409,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1410,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1411,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1411,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1411,"MT-RNR1","G-T","-","-","rRNA","0.000%","0","1"1412,"MT-RNR1","G-GG","-","-","rRNA","0.002%","1","1"1413,"MT-RNR1","T-del","-","-","rRNA","0.002%","1","1"1413,"MT-RNR1","T-C","-","-","rRNA","0.138%","82","4"1414,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1415,"MT-RNR1","G-A","-","-","rRNA","0.104%","62","4"1415,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1416,"MT-RNR1","A-G","-","-","rRNA","0.008%","5","1"1419,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1420,"MT-RNR1","T-C","-","-","rRNA","0.219%","130","7"1421,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1421,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"1422,"MT-RNR1","G-del","-","-","rRNA","0.002%","1","1"1422,"MT-RNR1","G-A","-","-","rRNA","0.010%","6","1"1422,"MT-RNR1","G-C","-","-","rRNA","0.002%","1","1"1423,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1424,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1428,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1429,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1431,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1431,"MT-RNR1","G-T","-","-","rRNA","0.000%","0","1"1435,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1438,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1438,"MT-RNR1","A-G","-","-","rRNA","95.124% ","56493","124"1439,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1440,"MT-RNR1","G-A","-","-","rRNA","0.003%","2","1"1442,"MT-RNR1","G-A","-","-","rRNA","0.616% ","366","11"1443,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1445,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1447,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1447,"MT-RNR1","G-C","-","-","rRNA","0.000%","0","1"1452,"MT-RNR1","T-C","-","-","rRNA","0.088%","52","2"1453,"MT-RNR1","A-G","-","-","rRNA","0.182%","108","3"1455,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1461,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1461,"MT-RNR1","A-G","-","-","rRNA","0.022%","13","1"1461,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1462,"MT-RNR1","G-A","-","-","rRNA","0.413% ","245","18"1462,"MT-RNR1","G-T","-","-","rRNA","0.076%","45","2"1463,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1464,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1465,"MT-RNR1","C-T","-","-","rRNA","0.003%","2","1"1466,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1468,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1469,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"1470,"MT-RNR1","A-C","-","-","rRNA","0.002%","1","1"1472,"MT-RNR1","G-A","-","-","rRNA","0.005%","3","2"1473,"MT-RNR1","C-T","-","-","rRNA","1.019%","605","2"1474,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1492,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1493,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1495,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1496,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1498,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1498,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1499,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1501,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1503,"MT-RNR1","G-A","-","-","rRNA","0.448% ","266","6"1503,"MT-RNR1","G-T","-","-","rRNA","0.002%","1","1"1508,"MT-RNR1","C-T","-","-","rRNA","0.037%","22","1"1511,"MT-RNR1","C-CT","-","-","rRNA","0.002%","1","1"1513,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1516,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1517,"MT-RNR1","A-G","-","-","rRNA","0.003%","2","1"1518,"MT-RNR1","C-CAC","-","-","rRNA","0.000%","0","1"1518,"MT-RNR1","C-T","-","-","rRNA","0.005%","3","1"1519,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1520,"MT-RNR1","T-C","-","-","rRNA","0.037%","22","4"1520,"MT-RNR1","T-G","-","-","rRNA","0.000%","0","1"1521,"MT-RNR1","T-C","-","-","rRNA","0.002%","1","1"1522,"MT-RNR1","T-TT","-","-","rRNA","0.000%","0","1"1523,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1524,"MT-RNR1","A-G","-","-","rRNA","0.020%","12","1"1525,"MT-RNR1","C-G","-","-","rRNA","0.000%","0","1"1525,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1529,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1530,"MT-RNR1","A-C","-","-","rRNA","0.000%","0","1"1530,"MT-RNR1","A-G","-","-","rRNA","0.039%","23","3"1530,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1531,"MT-RNR1","C-T","-","-","rRNA","0.035%","21","2"1532,"MT-RNR1","C-T","-","-","rRNA","0.002%","1","1"1535,"MT-RNR1","T-del","-","-","rRNA","0.002%","1","1"1535,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","2"1536,"MT-RNR1","A-G","-","-","rRNA","0.032%","19","4"1537,"MT-RNR1","C-T","-","-","rRNA","0.012%","7","3"1538,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1539,"MT-RNR1","C-A","-","-","rRNA","0.003%","2","1"1541,"MT-RNR1","T-C","-","-","rRNA","0.271% ","161","7"1542,"MT-RNR1","T-C","-","-","rRNA","0.008%","5","1"1546,"MT-RNR1","A-T","-","-","rRNA","0.000%","0","1"1547,"MT-RNR1","T-TT","-","-","rRNA","0.008%","5","1"1549,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1551,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1552,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1553,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1556,"MT-RNR1","C-T","-","-","rRNA","0.022%","13","1"1560,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1560,"MT-RNR1","T-G","-","-","rRNA","0.002%","1","1"1569,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1570,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1571,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1573,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1575,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1576,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1578,"MT-RNR1","A-G","-","-","rRNA","0.000%","0","1"1580,"MT-RNR1","T-C","-","-","rRNA","0.000%","0","1"1581,"MT-RNR1","G-A","-","-","rRNA","0.000%","0","1"1585,"MT-RNR1","A-G","-","-","rRNA","0.013%","8","1"1588,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1589,"MT-RNR1","C-A","-","-","rRNA","0.002%","1","1"1590,"MT-RNR1","A-G","-","-","rRNA","0.008%","5","1"1594,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1595,"MT-RNR1","G-A","-","-","rRNA","0.002%","1","1"1596,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1597,"MT-RNR1","C-A","-","-","rRNA","0.000%","0","1"1597,"MT-RNR1","C-T","-","-","rRNA","0.000%","0","1"1598,"MT-RNR1","G-A","-","-","rRNA","1.115% ","662","31"1600,"MT-RNR1","A-G","-","-","rRNA","0.002%","1","1"1601,"MT-RNR1","C-T","-","-","rRNA","0.010%","6","1"1603,"MT-TV","A-G","-","-","tRNA","0.002%","1","2"1604,"MT-TV","G-A","-","-","tRNA","0.000%","0","1"1607,"MT-TV","T-C","-","-","tRNA","0.020%","12","3"1608,"MT-TV","G-A","-","-","tRNA","0.002%","1","2"1609,"MT-TV","T-C","-","-","tRNA","0.000%","0","1"1614,"MT-TV","T-C","-","-","tRNA","0.000%","0","1"1616,"MT-TV","A-G","-","-","tRNA","0.000%","0","1"1617,"MT-TV","C-T","-","-","tRNA","0.003%","2","1"1618,"MT-TV","A-G","-","-","tRNA","0.015%","9","4"1619,"MT-TV","C-CT","-","-","tRNA","0.000%","0","1"1619,"MT-TV","C-T","-","-","tRNA","0.005%","3","1"1623,"MT-TV","G-A","-","-","tRNA","0.000%","0","1"1624,"MT-TV","C-T","-","-","tRNA","0.000%","0","1"1625,"MT-TV","A-G","-","-","tRNA","0.040%","24","1"1626,"MT-TV","C-T","-","-","tRNA","0.000%","0","1"1627,"MT-TV","C-A","-","-","tRNA","0.005%","3","1"1628,"MT-TV","C-T","-","-","tRNA","0.012%","7","3"1629,"MT-TV","A-C","-","-","tRNA","0.000%","0","1"1629,"MT-TV","A-G","-","-","tRNA","0.003%","2","1"1629,"MT-TV","A-T","-","-","tRNA","0.000%","0","1"1631,"MT-TV","C-A","-","-","tRNA","0.000%","0","1"1631,"MT-TV","C-T","-","-","tRNA","0.000%","0","1"1632,"MT-TV","T-C","-","-","tRNA","0.000%","0","1"1633,"MT-TV","T-C","-","-","tRNA","0.007%","4","2"1636,"MT-TV","A-G","-","-","tRNA","0.002%","1","1"1637,"MT-TV","C-T","-","-","tRNA","0.000%","0","1"1638,"MT-TV","T-C","-","-","tRNA","0.000%","0","1"1640,"MT-TV","A-G","-","-","tRNA","0.003%","2","2"1641,"MT-TV","G-A","-","-","tRNA","0.000%","0","1"1642,"MT-TV","G-A","-","-","tRNA","0.000%","0","1"1643,"MT-TV","A-G","-","-","tRNA","0.002%","1","2"1646,"MT-TV","T-C","-","-","tRNA","0.003%","2","2"1647,"MT-TV","T-C","-","-","tRNA","0.002%","1","1"1648,"MT-TV","T-C","-","-","tRNA","0.000%","0","1"1650,"MT-TV","A-G","-","-","tRNA","0.002%","1","1"1651,"MT-TV","A-G","-","-","tRNA","0.000%","0","1"1652,"MT-TV","C-A","-","-","tRNA","0.005%","3","1"1652,"MT-TV","C-T","-","-","tRNA","0.000%","0","1"1653,"MT-TV","T-C","-","-","tRNA","0.002%","1","1"1654,"MT-TV","T-C","-","-","tRNA","0.022%","13","1"1655,"MT-TV","A-G","-","-","tRNA","0.000%","0","2"1656,"MT-TV","A-del","-","-","tRNA","0.000%","0","4"1656,"MT-TV","A-C","-","-","tRNA","0.000%","0","1"1656,"MT-TV","A-G","-","-","tRNA","0.020%","12","1"1656,"MT-TV","A-T","-","-","tRNA","0.002%","1","1"1657,"MT-TV","C-T","-","-","tRNA","0.008%","5","1"1658,"MT-TV","T-C","-","-","tRNA","0.007%","4","2"1659,"MT-TV","T-C","-","-","tRNA","0.000%","0","1"1661,"MT-TV","A-G","-","-","tRNA","0.002%","1","1"1661,"MT-TV","A-T","-","-","tRNA","0.002%","1","1"1662,"MT-TV","C-T","-","-","tRNA","0.003%","2","1"1664,"MT-TV","G-A","-","-","tRNA","0.280%","166","9"1664,"MT-TV","G-C","-","-","tRNA","0.002%","1","1"1668,"MT-TV","T-G","-","-","tRNA","0.002%","1","1"1669,"MT-TV","G-A","-","-","tRNA","0.000%","0","1"1670,"MT-TV","A-T","-","-","tRNA","0.030%","18","3"1671,"MT-RNR2","G-T","-","-","rRNA","0.000%","0","1"1673,"MT-RNR2","T-C","-","-","rRNA","0.022%","13","1"1674,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1675,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1676,"MT-RNR2","A-G","-","-","rRNA","0.027%","16","1"1677,"MT-RNR2","C-T","-","-","rRNA","0.130%","77","4"1679,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1681,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"1683,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1684,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1685,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1685,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"1685,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1686,"MT-RNR2","A-G","-","-","rRNA","0.019%","11","1"1686,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1688,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"1688,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1688,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1689,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1690,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1690,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1691,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1692,"MT-RNR2","A-C","-","-","rRNA","0.015%","9","1"1692,"MT-RNR2","A-G","-","-","rRNA","0.274% ","163","4"1692,"MT-RNR2","A-T","-","-","rRNA","0.096%","57","5"1693,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1693,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"1694,"MT-RNR2","T-C","-","-","rRNA","0.194%","115","3"1695,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1696,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1698,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1699,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"1700,"MT-RNR2","T-C","-","-","rRNA","0.596% ","354","9"1700,"MT-RNR2","T-A","-","-","rRNA","0.002%","1","1"1700,"MT-RNR2","T-TC","-","-","rRNA","0.002%","1","1"1701,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1702,"MT-RNR2","A-AT","-","-","rRNA","0.000%","0","1"1703,"MT-RNR2","C-T","-","-","rRNA","0.251% ","149","4"1704,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1705,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1706,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"1706,"MT-RNR2","C-T","-","-","rRNA","0.232% ","138","3"1707,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1708,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"1708,"MT-RNR2","A-T","-","-","rRNA","0.005%","3","1"1709,"MT-RNR2","G-A","-","-","rRNA","0.342% ","203","14"1709,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"1709,"MT-RNR2","G-T","-","-","rRNA","0.032%","19","1"1710,"MT-RNR2","A-AT","-","-","rRNA","0.002%","1","1"1710,"MT-RNR2","A-C","-","-","rRNA","0.008%","5","1"1711,"MT-RNR2","C-T","-","-","rRNA","0.017%","10","2"1712,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"1712,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1713,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"1714,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1715,"MT-RNR2","C-T","-","-","rRNA","0.386%","229","11"1716,"MT-RNR2","T-C","-","-","rRNA","0.022%","13","2"1716,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"1717,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"1717,"MT-RNR2","T-C","-","-","rRNA","0.056%","33","4"1717,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"1718,"MT-RNR2","A-AA","-","-","rRNA","0.029%","17","1"1718,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1719,"MT-RNR2","G-A","-","-","rRNA","4.925% ","2925","60"1719,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"1719,"MT-RNR2","G-GG","-","-","rRNA","0.037%","22","1"1720,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1720,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","1"1721,"MT-RNR2","C-T","-","-","rRNA","0.818%","486","12"1722,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1723,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1725,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1728,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1729,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1730,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1733,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"1733,"MT-RNR2","C-T","-","-","rRNA","0.116%","69","2"1734,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1734,"MT-RNR2","C-T","-","-","rRNA","0.150%","89","3"1735,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1735,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1736,"MT-RNR2","A-G","-","-","rRNA","2.884% ","1713","30"1736,"MT-RNR2","A-T","-","-","rRNA","0.007%","4","1"1737,"MT-RNR2","A-G","-","-","rRNA","0.022%","13","1"1738,"MT-RNR2","T-C","-","-","rRNA","0.572% ","340","5"1743,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1745,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1746,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"1747,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","2"1748,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1748,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"1749,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1750,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1751,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1752,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1760,"MT-RNR2","G-A","-","-","rRNA","0.052%","31","1"1760,"MT-RNR2","G-GT","-","-","rRNA","0.000%","0","1"1761,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1761,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1762,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"1763,"MT-RNR2","A-G","-","-","rRNA","0.051%","30","3"1764,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"1765,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1766,"MT-RNR2","T-C","-","-","rRNA","0.056%","33","1"1766,"MT-RNR2","T-G","-","-","rRNA","0.007%","4","1"1767,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1768,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","2"1768,"MT-RNR2","G-GG","-","-","rRNA","0.000%","0","1"1770,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"1772,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1772,"MT-RNR2","A-T","-","-","rRNA","0.003%","2","1"1776,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1777,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1778,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1778,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"1779,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1780,"MT-RNR2","T-C","-","-","rRNA","0.456% ","271","7"1782,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1784,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1787,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1788,"MT-RNR2","C-T","-","-","rRNA","0.029%","17","2"1789,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1790,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"1790,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"1792,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1793,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1794,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1795,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1797,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1797,"MT-RNR2","G-GAAG","-","-","rRNA","0.000%","0","1"1798,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1799,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1800,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1802,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1804,"MT-RNR2","A-G","-","-","rRNA","0.039%","23","2"1804,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1806,"MT-RNR2","T-C","-","-","rRNA","0.049%","29","1"1807,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"1808,"MT-RNR2","A-G","-","-","rRNA","0.027%","16","2"1809,"MT-RNR2","T-C","-","-","rRNA","0.113%","67","1"1810,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"1810,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1811,"MT-RNR2","A-AA","-","-","rRNA","0.000%","0","1"1811,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"1811,"MT-RNR2","A-G","-","-","rRNA","7.648% ","4542","48"1811,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1812,"MT-RNR2","C-T","-","-","rRNA","0.010%","6","1"1813,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1814,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1815,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1816,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1817,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1818,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1819,"MT-RNR2","T-C","-","-","rRNA","0.057%","34","3"1820,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"1821,"MT-RNR2","A-G","-","-","rRNA","0.039%","23","3"1822,"MT-RNR2","T-C","-","-","rRNA","0.556% ","330","3"1824,"MT-RNR2","T-C","-","-","rRNA","0.359% ","213","7"1826,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1829,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"1830,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1831,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1832,"MT-RNR2","A-G","-","-","rRNA","0.012%","7","1"1833,"MT-RNR2","C-T","-","-","rRNA","0.015%","9","1"1834,"MT-RNR2","T-C","-","-","rRNA","0.039%","23","5"1835,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"1836,"MT-RNR2","A-G","-","-","rRNA","0.047%","28","4"1837,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"1837,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1838,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1839,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1841,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1842,"MT-RNR2","A-G","-","-","rRNA","0.394% ","234","6"1842,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1844,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1848,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1848,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"1849,"MT-RNR2","C-T","-","-","rRNA","0.093%","55","1"1850,"MT-RNR2","T-C","-","-","rRNA","0.236%","140","6"1852,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1854,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1855,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1858,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1859,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1860,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1861,"MT-RNR2","T-C","-","-","rRNA","0.010%","6","1"1864,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"1866,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1868,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"1869,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"1870,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1871,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"1872,"MT-RNR2","T-C","-","-","rRNA","0.035%","21","3"1872,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"1873,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1874,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1875,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"1876,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1878,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"1879,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1881,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1882,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1883,"MT-RNR2","G-A","-","-","rRNA","0.096%","57","1"1884,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"1887,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"1888,"MT-RNR2","G-A","-","-","rRNA","5.846% ","3472","31"1888,"MT-RNR2","G-C","-","-","rRNA","0.022%","13","1"1889,"MT-RNR2","C-A","-","-","rRNA","0.012%","7","1"1889,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1890,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"1891,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"1891,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"1891,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1892,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"1896,"MT-RNR2","T-C","-","-","rRNA","0.027%","16","3"1897,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1898,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1900,"MT-RNR2","A-C","-","-","rRNA","0.008%","5","1"1900,"MT-RNR2","A-G","-","-","rRNA","0.052%","31","4"1901,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"1901,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"1902,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1905,"MT-RNR2","C-CC","-","-","rRNA","0.000%","0","1"1906,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1909,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1910,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1913,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"1914,"MT-RNR2","A-G","-","-","rRNA","0.012%","7","1"1915,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"1917,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1918,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1920,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1922,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1923,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1924,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1925,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1926,"MT-RNR2","A-G","-","-","rRNA","0.015%","9","1"1926,"MT-RNR2","A-T","-","-","rRNA","0.027%","16","1"1927,"MT-RNR2","G-A","-","-","rRNA","0.052%","31","1"1928,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1929,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1934,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"1935,"MT-RNR2","A-G","-","-","rRNA","0.056%","33","2"1936,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1937,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"1937,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1938,"MT-RNR2","A-AA","-","-","rRNA","0.002%","1","1"1938,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1939,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1940,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1943,"MT-RNR2","A-G","-","-","rRNA","0.040%","24","2"1943,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"1944,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"1945,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1947,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"1948,"MT-RNR2","C-del","-","-","rRNA","0.002%","1","1"1949,"MT-RNR2","G-A","-","-","rRNA","0.008%","5","1"1952,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1954,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1955,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"1956,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1957,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"1957,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"1958,"MT-RNR2","G-A","-","-","rRNA","0.017%","10","1"1959,"MT-RNR2","C-T","-","-","rRNA","0.017%","10","1"1961,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"1961,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1962,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1963,"MT-RNR2","A-AA","-","-","rRNA","0.002%","1","2"1963,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1964,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1965,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1966,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1967,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1969,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"1970,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1971,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"1972,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1973,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1974,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1977,"MT-RNR2","T-C","-","-","rRNA","0.076%","45","3"1978,"MT-RNR2","A-C","-","-","rRNA","0.015%","9","1"1978,"MT-RNR2","A-G","-","-","rRNA","0.024%","14","2"1978,"MT-RNR2","A-T","-","-","rRNA","0.005%","3","1"1980,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"1981,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1982,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1983,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1985,"MT-RNR2","G-GT","-","-","rRNA","0.000%","0","1"1986,"MT-RNR2","A-C","-","-","rRNA","0.010%","6","1"1986,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1987,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"1990,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"1991,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"1991,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1992,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"1993,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"1994,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"1995,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"1998,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"1998,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"1999,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"1999,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2000,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2000,"MT-RNR2","C-T","-","-","rRNA","0.374%","222","3"2002,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2003,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2004,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2005,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2007,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2008,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2009,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2010,"MT-RNR2","T-C","-","-","rRNA","0.099%","59","3"2011,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2014,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2015,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2020,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2021,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2023,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2026,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2028,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2029,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2030,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2031,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2031,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2033,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2034,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2035,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2036,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2038,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2040,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2043,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2044,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2045,"MT-RNR2","A-G","-","-","rRNA","0.044%","26","1"2046,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2054,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2056,"MT-RNR2","G-A","-","-","rRNA","0.172%","102","4"2057,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2058,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2059,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2060,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"2060,"MT-RNR2","A-G","-","-","rRNA","0.015%","9","1"2061,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2061,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2062,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2064,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2065,"MT-RNR2","A-G","-","-","rRNA","0.017%","10","1"2066,"MT-RNR2","C-T","-","-","rRNA","0.010%","6","1"2068,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2068,"MT-RNR2","C-T","-","-","rRNA","0.013%","8","1"2069,"MT-RNR2","T-C","-","-","rRNA","0.019%","11","1"2070,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2070,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","1"2070,"MT-RNR2","CT-del","-","-","rRNA","0.000%","0","1"2071,"MT-RNR2","T-del","-","-","rRNA","0.002%","1","1"2071,"MT-RNR2","T-C","-","-","rRNA","0.030%","18","2"2071,"MT-RNR2","T-G","-","-","rRNA","0.005%","3","1"2072,"MT-RNR2","A-AT","-","-","rRNA","0.002%","1","1"2072,"MT-RNR2","A-G","-","-","rRNA","0.064%","38","1"2074,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","2"2074,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2074,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2075,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2075,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2076,"MT-RNR2","C-G","-","-","rRNA","0.039%","23","1"2077,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2078,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2078,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2079,"MT-RNR2","C-T","-","-","rRNA","0.037%","22","1"2080,"MT-RNR2","T-C","-","-","rRNA","0.064%","38","2"2083,"MT-RNR2","T-C","-","-","rRNA","0.140%","83","4"2085,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2086,"MT-RNR2","A-AA","-","-","rRNA","0.002%","1","1"2086,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2087,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2089,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2092,"MT-RNR2","C-T","-","-","rRNA","0.840% ","499","12"2093,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2095,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2096,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2097,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2098,"MT-RNR2","G-A","-","-","rRNA","0.140%","83","6"2098,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"2099,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2101,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2102,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2104,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2106,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2109,"MT-RNR2","A-G","-","-","rRNA","0.030%","18","1"2109,"MT-RNR2","A-T","-","-","rRNA","0.003%","2","2"2110,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2113,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2115,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2116,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2117,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2118,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2119,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2120,"MT-RNR2","G-A","-","-","rRNA","0.052%","31","1"2121,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2121,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"2122,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2122,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2123,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2123,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2124,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2124,"MT-RNR2","A-G","-","-","rRNA","0.013%","8","2"2124,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2125,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2126,"MT-RNR2","TA-del","-","-","rRNA","0.000%","0","1"2127,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2129,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2133,"MT-RNR2","A-C","-","-","rRNA","0.003%","2","1"2133,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2135,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","2"2135,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2135,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2140,"MT-RNR2","G-A","-","-","rRNA","0.084%","50","4"2140,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2141,"MT-RNR2","T-C","-","-","rRNA","0.118%","70","2"2142,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2143,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2145,"MT-RNR2","G-A","-","-","rRNA","0.017%","10","1"2146,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2146,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2149,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2149,"MT-RNR2","G-GAG","-","-","rRNA","0.005%","3","1"2150,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2151,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2153,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2154,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2156,"MT-RNR2","A-AA","-","-","rRNA","0.345% ","205","8"2156,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2156,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2157,"MT-RNR2","T-A","-","-","rRNA","0.002%","1","1"2157,"MT-RNR2","T-C","-","-","rRNA","0.015%","9","1"2157,"MT-RNR2","T-TA","-","-","rRNA","0.002%","1","1"2158,"MT-RNR2","T-C","-","-","rRNA","0.413%","245","11"2159,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2159,"MT-RNR2","T-C","-","-","rRNA","0.061%","36","3"2159,"MT-RNR2","T-TT","-","-","rRNA","0.000%","0","1"2160,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2160,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2161,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2162,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2163,"MT-RNR2","A-C","-","-","rRNA","0.010%","6","1"2163,"MT-RNR2","A-G","-","-","rRNA","0.012%","7","1"2163,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2164,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2165,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2166,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2168,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2169,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2170,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2171,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2171,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2172,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2173,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2174,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2175,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2177,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2178,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"2178,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2179,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2179,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2181,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2182,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2185,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2188,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2189,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2194,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2195,"MT-RNR2","A-G","-","-","rRNA","0.037%","22","2"2197,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2199,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2201,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2203,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2204,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2206,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2206,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2207,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2213,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2215,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2216,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2217,"MT-RNR2","C-T","-","-","rRNA","0.180%","107","5"2218,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2218,"MT-RNR2","C-T","-","-","rRNA","0.285% ","169","10"2219,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2219,"MT-RNR2","C-CC","-","-","rRNA","0.003%","2","2"2219,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2220,"MT-RNR2","A-AT","-","-","rRNA","0.000%","0","1"2220,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"2220,"MT-RNR2","A-G","-","-","rRNA","0.256%","152","5"2220,"MT-RNR2","A-T","-","-","rRNA","0.008%","5","4"2221,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2221,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2222,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2222,"MT-RNR2","T-C","-","-","rRNA","0.044%","26","1"2222,"MT-RNR2","T-G","-","-","rRNA","0.019%","11","1"2223,"MT-RNR2","A-G","-","-","rRNA","0.015%","9","1"2224,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2225,"MT-RNR2","C-A","-","-","rRNA","0.007%","4","2"2225,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2226,"MT-RNR2","T-C","-","-","rRNA","0.044%","26","1"2227,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2228,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2229,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2230,"MT-RNR2","A-AT","-","-","rRNA","0.003%","2","1"2230,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2231,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2232,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","2"2232,"MT-RNR2","A-AA","-","-","rRNA","1.142% ","678","5"2232,"MT-RNR2","A-AAA","-","-","rRNA","0.000%","0","2"2233,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2234,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2234,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2235,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2237,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2238,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2239,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"2239,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2241,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2242,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2243,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2244,"MT-RNR2","T-C","-","-","rRNA","0.024%","14","2"2244,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2245,"MT-RNR2","A-C","-","-","rRNA","0.083%","49","2"2245,"MT-RNR2","A-G","-","-","rRNA","1.228% ","729","6"2246,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2246,"MT-RNR2","A-G","-","-","rRNA","0.044%","26","6"2247,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2247,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2248,"MT-RNR2","T-C","-","-","rRNA","0.025%","15","2"2251,"MT-RNR2","A-G","-","-","rRNA","0.017%","10","1"2253,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2255,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2256,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2257,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2258,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2258,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2258,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2259,"MT-RNR2","C-T","-","-","rRNA","0.522% ","310","12"2260,"MT-RNR2","A-C","-","-","rRNA","0.007%","4","1"2260,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2261,"MT-RNR2","C-T","-","-","rRNA","0.008%","5","1"2262,"MT-RNR2","C-T","-","-","rRNA","0.008%","5","1"2263,"MT-RNR2","C-A","-","-","rRNA","0.062%","37","3"2263,"MT-RNR2","C-T","-","-","rRNA","0.051%","30","1"2264,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2264,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2265,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2267,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2269,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2270,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","2"2270,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"2271,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2272,"MT-RNR2","C-T","-","-","rRNA","0.013%","8","1"2274,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2275,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2277,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2279,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2280,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2280,"MT-RNR2","C-T","-","-","rRNA","0.069%","41","2"2281,"MT-RNR2","A-C","-","-","rRNA","0.007%","4","1"2281,"MT-RNR2","A-G","-","-","rRNA","0.071%","42","4"2282,"MT-RNR2","C-T","-","-","rRNA","0.030%","18","2"2283,"MT-RNR2","C-T","-","-","rRNA","0.098%","58","3"2284,"MT-RNR2","C-A","-","-","rRNA","0.010%","6","1"2284,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2285,"MT-RNR2","T-C","-","-","rRNA","0.008%","5","2"2288,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2293,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2294,"MT-RNR2","A-G","-","-","rRNA","0.290% ","172","3"2295,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2296,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2298,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2299,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2299,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2300,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2300,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2301,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2302,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2304,"MT-RNR2","G-A","-","-","rRNA","0.008%","5","1"2305,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2306,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2307,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2308,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2308,"MT-RNR2","A-G","-","-","rRNA","0.345% ","205","6"2310,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2311,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2313,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2315,"MT-RNR2","A-G","-","-","rRNA","0.118%","70","2"2316,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2317,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2320,"MT-RNR2","A-G","-","-","rRNA","0.017%","10","2"2320,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2321,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"2321,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2322,"MT-RNR2","C-A","-","-","rRNA","0.027%","16","1"2322,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","1"2323,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2324,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2325,"MT-RNR2","T-TT","-","-","rRNA","0.003%","2","1"2330,"MT-RNR2","T-C","-","-","rRNA","0.015%","9","2"2331,"MT-RNR2","C-A","-","-","rRNA","0.005%","3","1"2331,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2332,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2332,"MT-RNR2","C-T","-","-","rRNA","0.562% ","334","4"2333,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2334,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2335,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2336,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2338,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2339,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2344,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2344,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2345,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2346,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2349,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2350,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2350,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2351,"MT-RNR2","T-C","-","-","rRNA","0.020%","12","1"2352,"MT-RNR2","TA-del","-","-","rRNA","0.000%","0","1"2352,"MT-RNR2","T-C","-","-","rRNA","2.399% ","1425","9"2353,"MT-RNR2","A-C","-","-","rRNA","0.003%","2","1"2353,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2354,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2355,"MT-RNR2","A-G","-","-","rRNA","0.259% ","154","5"2355,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2356,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","1"2356,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2356,"MT-RNR2","A-G","-","-","rRNA","0.019%","11","1"2357,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","3"2357,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2358,"MT-RNR2","A-G","-","-","rRNA","0.222% ","132","5"2358,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2359,"MT-RNR2","C-T","-","-","rRNA","0.067%","40","1"2360,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2360,"MT-RNR2","T-C","-","-","rRNA","0.007%","4","1"2360,"MT-RNR2","TG-del","-","-","rRNA","0.002%","1","1"2361,"MT-RNR2","G-A","-","-","rRNA","0.241% ","143","6"2361,"MT-RNR2","G-T","-","-","rRNA","0.000%","0","1"2362,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2362,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2363,"MT-RNR2","A-AA","-","-","rRNA","0.002%","1","1"2363,"MT-RNR2","A-G","-","-","rRNA","0.042%","25","2"2366,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2368,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2370,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2371,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2375,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2377,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2378,"MT-RNR2","C-A","-","-","rRNA","0.012%","7","1"2378,"MT-RNR2","C-T","-","-","rRNA","0.039%","23","1"2379,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2380,"MT-RNR2","C-T","-","-","rRNA","0.083%","49","8"2383,"MT-RNR2","T-C","-","-","rRNA","0.007%","4","1"2385,"MT-RNR2","T-A","-","-","rRNA","0.002%","1","1"2385,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2386,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2386,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2387,"MT-RNR2","T-C","-","-","rRNA","0.209% ","124","5"2388,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2389,"MT-RNR2","C-A","-","-","rRNA","0.007%","4","1"2389,"MT-RNR2","C-T","-","-","rRNA","0.152%","90","5"2392,"MT-RNR2","T-del","-","-","rRNA","0.000%","0","1"2392,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2392,"MT-RNR2","T-C","-","-","rRNA","0.146%","87","6"2392,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2393,"MT-RNR2","C-del","-","-","rRNA","0.000%","0","1"2393,"MT-RNR2","C-T","-","-","rRNA","0.037%","22","1"2394,"MT-RNR2","AACCA-del","-","-","rRNA","0.002%","1","1"2394,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2394,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2394,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2395,"MT-RNR2","A-del","-","-","rRNA","0.160%","95","5"2395,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2396,"MT-RNR2","C-T","-","-","rRNA","0.015%","9","1"2397,"MT-RNR2","C-T","-","-","rRNA","0.024%","14","1"2398,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2398,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2399,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2400,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2401,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","2"2402,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2403,"MT-RNR2","G-A","-","-","rRNA","0.005%","3","1"2404,"MT-RNR2","T-C","-","-","rRNA","0.126%","75","7"2405,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2405,"MT-RNR2","C-CC","-","-","rRNA","0.106%","63","6"2405,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2405,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2406,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2407,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2410,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2412,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2413,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2413,"MT-RNR2","C-T","-","-","rRNA","0.015%","9","1"2414,"MT-RNR2","C-A","-","-","rRNA","0.008%","5","1"2414,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2415,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2416,"MT-RNR2","T-C","-","-","rRNA","2.952% ","1753","11"2417,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2417,"MT-RNR2","C-G","-","-","rRNA","0.008%","5","1"2417,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2418,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2418,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2420,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2423,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2425,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2426,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2429,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2430,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2434,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2435,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2436,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2437,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2438,"MT-RNR2","A-G","-","-","rRNA","0.020%","12","1"2438,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2442,"MT-RNR2","T-A","-","-","rRNA","0.007%","4","1"2442,"MT-RNR2","T-C","-","-","rRNA","0.534% ","317","6"2443,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2444,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2445,"MT-RNR2","T-C","-","-","rRNA","0.034%","20","3"2447,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2447,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2452,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","1"2452,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2453,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2454,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2455,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2456,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2457,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2461,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2462,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2463,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","1"2463,"MT-RNR2","A-AA","-","-","rRNA","0.002%","1","1"2463,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2465,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2469,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"2470,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2471,"MT-RNR2","G-GG","-","-","rRNA","0.003%","2","1"2476,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2476,"MT-RNR2","C-CC","-","-","rRNA","0.002%","1","1"2482,"MT-RNR2","A-AC","-","-","rRNA","0.000%","0","1"2482,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2483,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2483,"MT-RNR2","T-C","-","-","rRNA","0.175%","104","9"2484,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2484,"MT-RNR2","C-CC","-","-","rRNA","0.062%","37","1"2484,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"2484,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2485,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2485,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2486,"MT-RNR2","T-A","-","-","rRNA","0.002%","1","1"2486,"MT-RNR2","T-C","-","-","rRNA","0.019%","11","1"2486,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2486,"MT-RNR2","T-TT","-","-","rRNA","0.000%","0","1"2487,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"2487,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2491,"MT-RNR2","C-CC","-","-","rRNA","0.003%","2","1"2494,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"2497,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2501,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","1"2507,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2510,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2515,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2519,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"2523,"MT-RNR2","C-T","-","-","rRNA","0.025%","15","1"2524,"MT-RNR2","A-C","-","-","rRNA","0.012%","7","1"2524,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2524,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2525,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2526,"MT-RNR2","C-T","-","-","rRNA","0.019%","11","2"2528,"MT-RNR2","G-A","-","-","rRNA","0.005%","3","1"2532,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2533,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2534,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2535,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2536,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2539,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2540,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2541,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2542,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2542,"MT-RNR2","G-T","-","-","rRNA","0.000%","0","1"2544,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2545,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2550,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2550,"MT-RNR2","A-T","-","-","rRNA","0.003%","2","1"2551,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2556,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2556,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2557,"MT-RNR2","C-T","-","-","rRNA","0.012%","7","2"2558,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2558,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2559,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2561,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2563,"MT-RNR2","T-A","-","-","rRNA","0.002%","1","1"2563,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2564,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2572,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2573,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2574,"MT-RNR2","G-T","-","-","rRNA","0.000%","0","1"2575,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","2"2575,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2577,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2579,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2580,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2581,"MT-RNR2","A-G","-","-","rRNA","0.283% ","168","10"2582,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2583,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2586,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2589,"MT-RNR2","A-G","-","-","rRNA","0.010%","6","1"2592,"MT-RNR2","GG-del","-","-","rRNA","0.002%","1","1"2593,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2595,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"2595,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2600,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2602,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2607,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2609,"MT-RNR2","T-C","-","-","rRNA","0.010%","6","2"2612,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2614,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2616,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2617,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","2"2617,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2619,"MT-RNR2","A-G","-","-","rRNA","0.015%","9","1"2621,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2623,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2623,"MT-RNR2","A-G","-","-","rRNA","0.017%","10","2"2625,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2626,"MT-RNR2","T-A","-","-","rRNA","0.010%","6","1"2626,"MT-RNR2","T-C","-","-","rRNA","0.406% ","241","12"2626,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2628,"MT-RNR2","T-C","-","-","rRNA","0.022%","13","2"2630,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2631,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2631,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2633,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2633,"MT-Hum","A-G","-","-","rRNA","0.000%","0","1"2634,"MT-Hum","T-C","-","-","rRNA","0.002%","1","1"2634,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2635,"MT-Hum","G-A","-","-","rRNA","0.000%","0","1"2635,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2636,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2636,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2636,"MT-Hum","G-A","-","-","rRNA","0.002%","1","1"2636,"MT-Hum","G-C","-","-","rRNA","0.000%","0","1"2637,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2637,"MT-Hum","C-T","-","-","rRNA","0.000%","0","1"2638,"MT-RNR2","T-C","-","-","rRNA","0.032%","19","1"2638,"MT-Hum","T-C","-","-","rRNA","0.032%","19","1"2639,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2639,"MT-RNR2","C-T","-","-","rRNA","0.266% ","158","4"2639,"MT-Hum","C-T","-","-","rRNA","0.266% ","158","4"2639,"MT-Hum","C-A","-","-","rRNA","0.002%","1","1"2643,"MT-Hum","G-A","-","-","rRNA","0.003%","2","1"2643,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2646,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2646,"MT-Hum","G-A","-","-","rRNA","0.000%","0","1"2648,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2648,"MT-Hum","T-C","-","-","rRNA","0.002%","1","1"2649,"MT-Hum","T-C","-","-","rRNA","0.022%","13","1"2649,"MT-RNR2","T-C","-","-","rRNA","0.022%","13","1"2650,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2650,"MT-Hum","C-T","-","-","rRNA","0.002%","1","1"2652,"MT-RNR2","G-A","-","-","rRNA","0.022%","13","1"2652,"MT-Hum","G-A","-","-","rRNA","0.022%","13","1"2653,"MT-RNR2","C-del","-","-","rRNA","0.002%","1","1"2653,"MT-Hum","C-del","-","-","rRNA","0.002%","1","1"2654,"MT-Hum","T-C","-","-","rRNA","0.000%","0","1"2654,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2658,"MT-Hum","T-C","-","-","rRNA","0.000%","0","1"2658,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2664,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2664,"MT-Hum","T-C","-","-","rRNA","0.000%","0","1"2666,"MT-Hum","T-C","-","-","rRNA","0.000%","0","1"2666,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2667,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2667,"MT-Hum","T-C","-","-","rRNA","0.005%","3","1"2668,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2668,"MT-Hum","A-G","-","-","rRNA","0.002%","1","1"2672,"MT-Hum","A-G","-","-","rRNA","0.035%","21","3"2672,"MT-RNR2","A-G","-","-","rRNA","0.035%","21","3"2674,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2674,"MT-Hum","T-C","-","-","rRNA","0.002%","1","1"2679,"MT-Hum","T-C","-","-","rRNA","0.003%","2","1"2679,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2680,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2680,"MT-Hum","T-A","-","-","rRNA","0.000%","0","1"2686,"MT-RNR2","G-A","-","-","rRNA","0.019%","11","1"2686,"MT-Hum","G-A","-","-","rRNA","0.019%","11","1"2687,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2687,"MT-Hum","C-T","-","-","rRNA","0.002%","1","1"2689,"MT-Hum","C-T","-","-","rRNA","0.002%","1","1"2689,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2689,"MT-RNR2","C-CC","-","-","rRNA","0.002%","1","1"2689,"MT-Hum","C-CC","-","-","rRNA","0.002%","1","1"2690,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2690,"MT-Hum","G-A","-","-","rRNA","0.003%","2","1"2695,"MT-Hum","G-A","-","-","rRNA","0.010%","6","1"2695,"MT-RNR2","G-A","-","-","rRNA","0.010%","6","1"2697,"MT-Hum","G-A","-","-","rRNA","0.000%","0","1"2697,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2698,"MT-Hum","G-A","-","-","rRNA","0.000%","0","1"2698,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2700,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"2700,"MT-Hum","G-T","-","-","rRNA","0.002%","1","1"2700,"MT-Hum","G-C","-","-","rRNA","0.002%","1","1"2700,"MT-Hum","G-A","-","-","rRNA","0.000%","0","1"2700,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2700,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"2701,"MT-RNR2","G-A","-","-","rRNA","0.008%","5","1"2701,"MT-Hum","G-A","-","-","rRNA","0.008%","5","1"2702,"MT-Hum","G-A","-","-","rRNA","0.163%","97","7"2702,"MT-RNR2","G-A","-","-","rRNA","0.163%","97","7"2703,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"2703,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2703,"MT-Hum","C-T","-","-","rRNA","0.000%","0","1"2703,"MT-Hum","C-G","-","-","rRNA","0.002%","1","1"2704,"MT-Hum","A-del","-","-","rRNA","0.002%","1","1"2704,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"2704,"MT-Hum","A-G","-","-","rRNA","0.002%","1","1"2704,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2706,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2706,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"2706,"MT-RNR2","A-G","-","-","rRNA","77.871% ","46247","124"2707,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2707,"MT-RNR2","A-C","-","-","rRNA","0.034%","20","2"2707,"MT-RNR2","A-G","-","-","rRNA","0.103%","61","4"2708,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2708,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2709,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2709,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2709,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2710,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2712,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2713,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","2"2716,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2719,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2721,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2723,"MT-RNR2","A-AA","-","-","rRNA","0.002%","1","1"2725,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2728,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2729,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2730,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2731,"MT-RNR2","T-G","-","-","rRNA","0.003%","2","1"2731,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2733,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2733,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2734,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2735,"MT-RNR2","G-A","-","-","rRNA","0.042%","25","2"2736,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2737,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2738,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2738,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2738,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2739,"MT-RNR2","T-TT","-","-","rRNA","0.002%","1","1"2739,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2740,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2741,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2743,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2744,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2746,"MT-RNR2","T-C","-","-","rRNA","0.054%","32","5"2748,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2749,"MT-RNR2","A-G","-","-","rRNA","0.024%","14","1"2750,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2752,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2754,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2755,"MT-RNR2","A-G","-","-","rRNA","0.450% ","267","9"2755,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2756,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2756,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2756,"MT-RNR2","C-T","-","-","rRNA","0.012%","7","2"2757,"MT-RNR2","A-G","-","-","rRNA","0.210%","125","8"2757,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2758,"MT-RNR2","G-A","-","-","rRNA","4.460% ","2649","12"2759,"MT-RNR2","T-C","-","-","rRNA","0.024%","14","1"2760,"MT-RNR2","A-G","-","-","rRNA","0.040%","24","3"2761,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2762,"MT-RNR2","C-T","-","-","rRNA","0.025%","15","1"2762,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2763,"MT-RNR2","T-C","-","-","rRNA","0.012%","7","3"2764,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2764,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2765,"MT-RNR2","A-AA","-","-","rRNA","0.000%","0","1"2765,"MT-RNR2","A-G","-","-","rRNA","0.030%","18","2"2766,"MT-RNR2","C-CT","-","-","rRNA","0.000%","0","1"2766,"MT-RNR2","C-A","-","-","rRNA","0.017%","10","2"2766,"MT-RNR2","C-T","-","-","rRNA","0.069%","41","8"2768,"MT-RNR2","A-G","-","-","rRNA","0.611% ","363","6"2768,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2769,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2770,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2772,"MT-RNR2","C-T","-","-","rRNA","0.317% ","188","15"2772,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2772,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2774,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2775,"MT-RNR2","A-G","-","-","rRNA","0.045%","27","2"2776,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2777,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2778,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"2778,"MT-RNR2","T-C","-","-","rRNA","0.005%","3","1"2779,"MT-RNR2","C-T","-","-","rRNA","0.012%","7","1"2780,"MT-RNR2","C-T","-","-","rRNA","0.027%","16","1"2780,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2781,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2783,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2784,"MT-RNR2","A-C","-","-","rRNA","0.003%","2","1"2784,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2785,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2785,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2786,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2786,"MT-RNR2","T-C","-","-","rRNA","0.027%","16","2"2788,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2789,"MT-RNR2","C-T","-","-","rRNA","1.852% ","1100","10"2789,"MT-RNR2","C-CT","-","-","rRNA","0.002%","1","1"2789,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"2790,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2791,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2792,"MT-RNR2","A-G","-","-","rRNA","0.042%","25","2"2792,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","2"2792,"MT-RNR2","A-C","-","-","rRNA","0.008%","5","1"2793,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2803,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2804,"MT-RNR2","A-G","-","-","rRNA","0.013%","8","1"2804,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2805,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2805,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","1"2805,"MT-RNR2","A-AA","-","-","rRNA","0.003%","2","1"2805,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2806,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2809,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2809,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2811,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2813,"MT-RNR2","T-del","-","-","rRNA","0.000%","0","1"2814,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2814,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2817,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2818,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","1"2818,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2819,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2820,"MT-RNR2","ACCTCGGAGCAGAACCCA-del","-","-","rRNA","0.000%","0","1"2820,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2821,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2825,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2826,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2829,"MT-RNR2","C-T","-","-","rRNA","0.010%","6","2"2831,"MT-RNR2","G-T","-","-","rRNA","0.168%","100","2"2831,"MT-RNR2","G-A","-","-","rRNA","0.168%","100","6"2831,"MT-RNR2","G-C","-","-","rRNA","0.000%","0","1"2832,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2833,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"2833,"MT-RNR2","A-G","-","-","rRNA","0.320%","190","4"2834,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2834,"MT-RNR2","C-T","-","-","rRNA","0.012%","7","1"2835,"MT-RNR2","C-A","-","-","rRNA","0.013%","8","1"2835,"MT-RNR2","C-T","-","-","rRNA","0.116%","69","5"2836,"MT-RNR2","C-T","-","-","rRNA","0.057%","34","1"2836,"MT-RNR2","C-A","-","-","rRNA","0.178%","106","1"2837,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2838,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2838,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2841,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2844,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"2846,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2847,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2848,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2849,"MT-RNR2","G-A","-","-","rRNA","0.024%","14","2"2850,"MT-RNR2","T-C","-","-","rRNA","0.214%","127","4"2850,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"2851,"MT-RNR2","A-G","-","-","rRNA","0.077%","46","4"2851,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2851,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2852,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2852,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2852,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2853,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2854,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2854,"MT-RNR2","T-G","-","-","rRNA","0.005%","3","1"2855,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2856,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2856,"MT-RNR2","C-T","-","-","rRNA","0.013%","8","2"2857,"MT-RNR2","T-C","-","-","rRNA","0.074%","44","1"2858,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2859,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2861,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2863,"MT-RNR2","T-C","-","-","rRNA","0.128%","76","2"2864,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2864,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2865,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2866,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2868,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2870,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2871,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2872,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2873,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2875,"MT-RNR2","A-G","-","-","rRNA","0.024%","14","1"2876,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2878,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"2878,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2879,"MT-RNR2","A-G","-","-","rRNA","0.013%","8","1"2880,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2880,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","1"2880,"MT-RNR2","A-G","-","-","rRNA","0.064%","38","2"2881,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2882,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2882,"MT-RNR2","T-C","-","-","rRNA","0.008%","5","2"2883,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2883,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2883,"MT-RNR2","AC-del","-","-","rRNA","0.000%","0","1"2884,"MT-RNR2","C-T","-","-","rRNA","0.035%","21","1"2884,"MT-RNR2","C-G","-","-","rRNA","0.003%","2","1"2885,"MT-RNR2","T-C","-","-","rRNA","4.437% ","2635","16"2885,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2886,"MT-RNR2","A-del","-","-","rRNA","0.003%","2","1"2886,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2886,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2887,"MT-RNR2","T-C","-","-","rRNA","0.296%","176","9"2887,"MT-RNR2","TA-del","-","-","rRNA","0.022%","13","1"2889,"MT-RNR2","C-T","-","-","rRNA","0.051%","30","1"2889,"MT-RNR2","C-G","-","-","rRNA","0.000%","0","1"2889,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"2890,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2891,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2891,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"2892,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2893,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2896,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2897,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2898,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2903,"MT-RNR2","T-C","-","-","rRNA","0.012%","7","1"2904,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2904,"MT-RNR2","A-T","-","-","rRNA","0.003%","2","1"2905,"MT-RNR2","A-G","-","-","rRNA","0.030%","18","2"2905,"MT-RNR2","A-del","-","-","rRNA","0.000%","0","1"2906,"MT-RNR2","C-T","-","-","rRNA","0.010%","6","1"2906,"MT-RNR2","C-A","-","-","rRNA","0.005%","3","1"2908,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2909,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2911,"MT-RNR2","C-T","-","-","rRNA","0.005%","3","1"2912,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2913,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2914,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2916,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2917,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2917,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"2921,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2924,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2925,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2926,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"2926,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2927,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2929,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2931,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2932,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2934,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2935,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2938,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"2939,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"2940,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"2940,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"2943,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2945,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2946,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2947,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"2949,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2951,"MT-RNR2","A-G","-","-","rRNA","0.019%","11","2"2952,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2953,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2955,"MT-RNR2","T-A","-","-","rRNA","0.002%","1","1"2955,"MT-RNR2","T-C","-","-","rRNA","0.007%","4","2"2958,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"2960,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"2961,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"2963,"MT-RNR2","A-G","-","-","rRNA","0.008%","5","1"2964,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2967,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","1"2968,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"2969,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"2971,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"2971,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"2972,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2973,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"2974,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2977,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2978,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2982,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"2983,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"2984,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"2985,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"2989,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2991,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"2992,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"2996,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3000,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3003,"MT-RNR2","A-G","-","-","rRNA","0.003%","2","1"3005,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3006,"MT-RNR2","T-G","-","-","rRNA","0.002%","1","1"3006,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"3008,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3008,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"3009,"MT-RNR2","C-T","-","-","rRNA","0.003%","2","1"3009,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"3010,"MT-RNR2","G-A","-","-","rRNA","15.269% ","9068","106"3013,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3014,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"3015,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3016,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3017,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"3019,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"3019,"MT-RNR2","G-A","-","-","rRNA","0.003%","2","1"3022,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3027,"MT-RNR2","T-C","-","-","rRNA","1.020% ","606","8"3028,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3030,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3031,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3033,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"3036,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3039,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3041,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3052,"MT-RNR2","A-AC","-","-","rRNA","0.000%","0","1"3052,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3052,"MT-RNR2","A-AT","-","-","rRNA","0.000%","0","1"3053,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3055,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3057,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"3058,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"3062,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3076,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3077,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3079,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"3080,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3082,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"3083,"MT-RNR2","T-C","-","-","rRNA","0.059%","35","7"3084,"MT-RNR2","A-G","-","-","rRNA","0.020%","12","3"3087,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"3089,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3091,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3095,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"3096,"MT-RNR2","TTTCTATCTAC-del","-","-","rRNA","0.002%","1","1"3097,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"3099,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3100,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"3101,"MT-RNR2","A-del","-","-","rRNA","0.027%","16","1"3102,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3105,"MT-RNR2","A-G","-","-","rRNA","0.152%","90","4"3106,"MT-RNR2","CN-del","-","-","rRNA","0.091%","54","1"3106,"MT-RNR2","C-del","-","-","rRNA","0.005%","3","1"3106,"MT-RNR2","C-A","-","-","rRNA","0.426%","253","1"3107,"MT-RNR2","NT-del","-","-","(3108 or 3109 T-del)","0.005%",":&purge_type=\" target=_blank>3","1"3109,"MT-RNR2","T-A","-","-","rRNA","0.008%","5","1"3109,"MT-RNR2","T-del","-","-","(see also 3107 NT-del)","0.003%","2","1"3109,"MT-RNR2","T-C","-","-","rRNA","0.019%","11","1"3110,"MT-RNR2","CA-del","-","-","rRNA","0.000%","0","1"3110,"MT-RNR2","C-del","-","-","rRNA","0.002%","1","1"3110,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"3110,"MT-RNR2","C-T","-","-","rRNA","0.015%","9","1"3111,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3111,"MT-RNR2","A-T","-","-","rRNA","0.010%","6","0"3112,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"3112,"MT-RNR2","A-ACGT","-","-","rRNA","0.000%","0","1"3112,"MT-RNR2","A-AT","-","-","rRNA","0.000%","0","1"3112,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3113,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3114,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3116,"MT-RNR2","C-T","-","-","rRNA","0.212%","126","7"3117,"MT-RNR2","C-del","-","-","rRNA","0.002%","1","1"3118,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3122,"MT-RNR2","T-A","-","-","rRNA","0.000%","0","1"3123,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3125,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3133,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"3136,"MT-RNR2","A-del","-","-","rRNA","0.002%","1","1"3140,"MT-RNR2","A-G","-","-","rRNA","0.056%","33","1"3144,"MT-RNR2","A-G","-","-","rRNA","0.045%","27","4"3145,"MT-RNR2","A-G","-","-","rRNA","0.034%","20","4"3146,"MT-RNR2","G-A","-","-","rRNA","0.005%","3","1"3148,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"3150,"MT-RNR2","T-C","-","-","rRNA","0.077%","46","1"3153,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3154,"MT-RNR2","T-C","-","-","rRNA","0.002%","1","1"3154,"MT-RNR2","T-del","-","-","rRNA","0.002%","1","1"3155,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3156,"MT-RNR2","A-G","-","-","rRNA","0.005%","3","1"3157,"MT-RNR2","C-A","-","-","rRNA","0.002%","1","1"3157,"MT-RNR2","C-T","-","-","rRNA","0.010%","6","1"3157,"MT-RNR2","C-CT","-","-","rRNA","0.002%","1","1"3158,"MT-RNR2","A-AT","-","-","rRNA","0.091%","54","2"3159,"MT-RNR2","A-AT","-","-","rRNA","0.002%","1","1"3160,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3160,"MT-RNR2","A-AA","-","-","rRNA","0.000%","0","1"3160,"MT-RNR2","A-del","-","-","rRNA","0.005%","3","1"3161,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3163,"MT-RNR2","G-A","-","-","rRNA","0.002%","1","1"3166,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3167,"MT-RNR2","T-TT","-","-","rRNA","0.010%","6","1"3167,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3168,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3168,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"3169,"MT-RNR2","C-T","-","-","rRNA","0.012%","7","1"3169,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"3170,"MT-RNR2","C-A","-","-","rRNA","0.012%","7","2"3171,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3171,"MT-RNR2","C-A","-","-","rRNA","0.003%","2","1"3172,"MT-RNR2","C-CC","-","-","rRNA","0.096%","57","9"3172,"MT-RNR2","C-A","-","-","rRNA","0.022%","13","1"3172,"MT-RNR2","C-T","-","-","rRNA","0.007%","4","2"3173,"MT-RNR2","G-A","-","-","rRNA","0.025%","15","1"3174,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3175,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3176,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3177,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3178,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3180,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3181,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3183,"MT-RNR2","T-C","-","-","rRNA","0.007%","4","1"3184,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"3184,"MT-RNR2","C-T","-","-","rRNA","0.008%","5","1"3189,"MT-RNR2","C-T","-","-","rRNA","0.002%","1","1"3191,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3192,"MT-RNR2","C-T","-","-","rRNA","0.052%","31","2"3196,"MT-RNR2","G-C","-","-","rRNA","0.002%","1","1"3196,"MT-RNR2","G-A","-","-","rRNA","0.025%","15","1"3196,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"3197,"MT-RNR2","T-C","-","-","rRNA","4.208% ","2499","37"3198,"MT-RNR2","A-G","-","-","rRNA","0.007%","4","1"3198,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"3199,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"3199,"MT-RNR2","T-A","-","-","rRNA","0.019%","11","1"3199,"MT-RNR2","T-C","-","-","rRNA","0.003%","2","1"3200,"MT-RNR2","T-A","-","-","rRNA","0.258% ","153","3"3200,"MT-RNR2","T-C","-","-","rRNA","0.130%","77","4"3201,"MT-RNR2","A-T","-","-","rRNA","0.002%","1","1"3201,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3202,"MT-RNR2","T-C","-","-","rRNA","0.069%","41","4"3202,"MT-RNR2","T-G","-","-","rRNA","0.000%","0","1"3203,"MT-RNR2","A-T","-","-","rRNA","0.005%","3","1"3203,"MT-RNR2","A-G","-","-","rRNA","0.187%","111","9"3204,"MT-RNR2","C-T","-","-","rRNA","0.308% ","183","6"3204,"MT-RNR2","C-G","-","-","rRNA","0.002%","1","1"3205,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"3206,"MT-RNR3","C-del","-","-","rRNA","0.002%","1","1"3206,"MT-RNR3","C-A","-","-","rRNA","0.000%","0","1"3206,"MT-RNR2","C-T","-","-","rRNA","0.300% ","178","17"3206,"MT-RNR2","C-A","-","-","rRNA","0.000%","0","1"3206,"MT-RNR2","C-del","-","-","rRNA","0.002%","1","1"3206,"MT-RNR3","C-T","-","-","rRNA","0.300% ","178","17"3207,"MT-RNR3","A-G","-","-","rRNA","0.000%","0","1"3207,"MT-RNR2","A-G","-","-","rRNA","0.000%","0","1"3207,"MT-RNR2","A-C","-","-","rRNA","0.000%","0","1"3207,"MT-RNR3","A-C","-","-","rRNA","0.000%","0","1"3208,"MT-RNR2","C-T","-","-","rRNA","0.019%","11","1"3208,"MT-RNR3","C-T","-","-","rRNA","0.019%","11","1"3209,"MT-RNR2","A-T","-","-","rRNA","0.010%","6","1"3209,"MT-RNR2","A-C","-","-","rRNA","0.002%","1","1"3209,"MT-RNR2","A-G","-","-","rRNA","0.020%","12","4"3209,"MT-RNR3","A-C","-","-","rRNA","0.002%","1","1"3209,"MT-RNR3","A-G","-","-","rRNA","0.020%","12","4"3209,"MT-RNR3","A-T","-","-","rRNA","0.010%","6","1"3210,"MT-RNR2","C-T","-","-","rRNA","0.094%","56","2"3210,"MT-RNR3","C-T","-","-","rRNA","0.094%","56","2"3211,"MT-RNR3","C-T","-","-","rRNA","0.027%","16","1"3211,"MT-RNR2","C-T","-","-","rRNA","0.027%","16","1"3212,"MT-RNR2","C-T","-","-","rRNA","0.126%","75","4"3212,"MT-RNR3","C-T","-","-","rRNA","0.126%","75","4"3213,"MT-RNR3","A-G","-","-","rRNA","0.042%","25","2"3213,"MT-RNR2","A-T","-","-","rRNA","0.000%","0","1"3213,"MT-RNR2","A-G","-","-","rRNA","0.042%","25","2"3213,"MT-RNR3","A-T","-","-","rRNA","0.000%","0","1"3214,"MT-RNR3","C-T","-","-","rRNA","0.000%","0","1"3214,"MT-RNR2","C-T","-","-","rRNA","0.000%","0","1"3217,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3217,"MT-RNR3","A-G","-","-","rRNA","0.002%","1","1"3219,"MT-RNR3","G-A","-","-","rRNA","0.000%","0","1"3219,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3220,"MT-RNR3","A-G","-","-","rRNA","0.002%","1","1"3220,"MT-RNR2","A-G","-","-","rRNA","0.002%","1","1"3221,"MT-RNR3","A-G","-","-","rRNA","0.136%","81","2"3221,"MT-RNR2","A-G","-","-","rRNA","0.136%","81","2"3225,"MT-RNR3","G-A","-","-","rRNA","0.000%","0","1"3225,"MT-RNR2","G-A","-","-","rRNA","0.000%","0","1"3226,"MT-RNR2","G-T","-","-","rRNA","0.002%","1","1"3226,"MT-RNR3","G-T","-","-","rRNA","0.002%","1","1"3227,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3227,"MT-RNR3","T-C","-","-","rRNA","0.000%","0","1"3228,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3228,"MT-RNR3","T-TA","-","-","rRNA","0.000%","0","1"3228,"MT-RNR3","T-C","-","-","rRNA","0.000%","0","1"3228,"MT-RNR2","T-TA","-","-","rRNA","0.000%","0","1"3229,"MT-RNR2","T-TT","-","-","rRNA","0.002%","1","1"3229,"MT-RNR2","T-TA","-","-","rRNA","0.012%","7","1"3229,"MT-RNR2","T-C","-","-","rRNA","0.000%","0","1"3229,"MT-TER","T-TA","-","-","rRNA","0.012%","7","1"3229,"MT-TER","T-TC","-","-","rRNA","0.002%","1","1"3229,"MT-TER","T-TT","-","-","rRNA","0.002%","1","1"3229,"MT-RNR2","T-TC","-","-","rRNA","0.002%","1","1"3229,"MT-RNR3","T-C","-","-","rRNA","0.000%","0","1"3229,"MT-RNR3","T-TA","-","-","rRNA","0.012%","7","1"3229,"MT-RNR3","T-TC","-","-","rRNA","0.002%","1","1"3229,"MT-RNR3","T-TT","-","-","rRNA","0.002%","1","1"3229,"MT-TER","T-C","-","-","rRNA","0.000%","0","1"3233,"MT-TL1","A-T","-","-","tRNA","0.002%","1","1"3233,"MT-TER","A-T","-","-","tRNA","0.002%","1","1"3234,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3234,"MT-TER","A-G","-","-","tRNA","0.000%","0","1"3236,"MT-TER","A-G","-","-","tRNA","0.000%","0","1"3236,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3238,"MT-TL1","G-A","-","-","tRNA","0.002%","1","1"3238,"MT-TER","G-A","-","-","tRNA","0.002%","1","1"3239,"MT-TL1","G-A","-","-","tRNA","0.000%","0","1"3239,"MT-TER","G-A","-","-","tRNA","0.000%","0","1"3241,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3241,"MT-TER","A-G","-","-","tRNA","0.000%","0","1"3242,"MT-TL1","G-C","-","-","tRNA","0.002%","1","1"3242,"MT-TER","G-C","-","-","tRNA","0.002%","1","1"3242,"MT-TER","G-A","-","-","tRNA","0.000%","0","1"3242,"MT-TL1","G-A","-","-","tRNA","0.000%","0","1"3243,"MT-TER","A-C","-","-","tRNA","0.000%","0","1"3243,"MT-TL1","A-C","-","-","tRNA","0.000%","0","1"3244,"MT-TL1","G-A","-","-","tRNA","0.010%","6","0"3244,"MT-TER","G-A","-","-","tRNA","0.010%","6","0"3248,"MT-TL1","G-A","-","-","tRNA","0.002%","1","1"3248,"MT-TER","G-A","-","-","tRNA","0.002%","1","1"3250,"MT-TER","T-C","-","-","tRNA","0.002%","1","2"3250,"MT-TL1","T-C","-","-","tRNA","0.002%","1","2"3251,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3251,"MT-TER","A-G","-","-","tRNA","0.000%","0","1"3253,"MT-TER","T-C","-","-","tRNA","0.012%","7","0"3253,"MT-TL1","T-C","-","-","tRNA","0.012%","7","0"3254,"MT-TL1","C-T","-","-","tRNA","0.029%","17","6"3254,"MT-TER","C-T","-","-","tRNA","0.029%","17","6"3254,"MT-TER","C-A","-","-","tRNA","0.054%","32","4"3254,"MT-TL1","C-A","-","-","tRNA","0.054%","32","4"3255,"MT-TER","G-A","-","-","tRNA","0.000%","0","1"3255,"MT-TL1","G-A","-","-","tRNA","0.000%","0","1"3261,"MT-TL1","A-G","-","-","tRNA","0.012%","7","3"3262,"MT-TL1","A-T","-","-","tRNA","0.000%","0","1"3263,"MT-TL1","C-T","-","-","tRNA","0.000%","0","1"3264,"MT-TL1","T-C","-","-","tRNA","0.000%","0","1"3268,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3269,"MT-TL1","A-C","-","-","tRNA","0.000%","0","1"3269,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3269,"MT-TL1","A-T","-","-","tRNA","0.000%","0","1"3272,"MT-TL1","T-C","-","-","tRNA","0.000%","0","1"3275,"MT-TL1","C-A","-","-","tRNA","0.002%","1","1"3275,"MT-TL1","C-G","-","-","tRNA","0.093%","55","3"3275,"MT-TL1","C-T","-","-","tRNA","0.000%","0","1"3276,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3277,"MT-TL1","G-A","-","-","tRNA","0.061%","36","6"3277,"MT-TL1","G-T","-","-","tRNA","0.003%","2","1"3278,"MT-TL1","T-C","-","-","tRNA","0.002%","1","1"3281,"MT-TL1","G-A","-","-","tRNA","0.003%","2","1"3285,"MT-TL1","T-C","-","-","tRNA","0.000%","0","1"3289,"MT-TL1","A-G","-","-","tRNA","0.000%","0","1"3290,"MT-TL1","T-A","-","-","tRNA","0.000%","0","1"3290,"MT-TL1","T-C","-","-","tRNA","0.216% ","128","18"3290,"MT-TL1","T-G","-","-","tRNA","0.002%","1","1"3294,"MT-TL1","T-C","-","-","tRNA","0.002%","1","1"3298,"MT-TL1","C-T","-","-","tRNA","0.002%","1","1"3305,"MT-NC1","A-G","-","-","non-coding","0.013%","8","1"3306,"MT-NC1","C-T","-","-","non-coding","0.045%","27","1"3307,"MT-ND1","A-AA","1","1","frameshift","0.032%","19","2"3307,"MT-ND1","A-C","1","1","M-L","0.000%","0","1"3307,"MT-ND1","A-G","1","1","M-V","0.000%","0","1"3307,"MT-ND1","A-T","1","1","M-L","0.000%","0","1"3308,"MT-ND1","T-A","1","2","M-K","0.003%","2","1"3308,"MT-ND1","T-C","1","2","M-T","0.690% ","410","17"3308,"MT-ND1","T-G","1","2","M-Term","0.010%","6","3"3308,"MT-ND1","T-TC","1","2","frameshift","0.002%","1","1"3309,"MT-ND1","A-G","1","3","M-M","0.000%","0","1"3309,"MT-ND1","A-T","1","3","M-M","0.000%","0","1"3310,"MT-ND1","C-A","2","1","P-T","0.000%","0","1"3310,"MT-ND1","C-T","2","1","P-S","0.022%","13","1"3311,"MT-ND1","C-T","2","2","P-L","0.037%","22","1"3312,"MT-ND1","C-CC","2","3","frameshift","0.002%","1","1"3312,"MT-ND1","C-T","2","3","P-P","0.002%","1","1"3313,"MT-ND1","A-G","3","1","M3V","0.000%","0","1"3315,"MT-ND1","G-A","3","3","M-M","0.002%","1","1"3316,"MT-ND1","G-A","4","1","A-T","0.938% ","557","21"3316,"MT-ND1","G-C","4","1","A-P","0.000%","0","1"3317,"MT-ND1","C-G","4","2","A-G","0.000%","0","1"3317,"MT-ND1","C-T","4","2","A-V","0.003%","2","1"3318,"MT-ND1","C-G","4","3","A-A","0.000%","0","1"3318,"MT-ND1","C-T","4","3","A-A","0.008%","5","1"3319,"MT-ND1","A-G","5","1","N-D","0.017%","10","1"3320,"MT-ND1","A-G","5","2","N-S","0.000%","0","1"3321,"MT-ND1","C-T","5","3","N-N","0.013%","8","1"3322,"MT-ND1","C-A","6","1","L-I","0.000%","0","1"3322,"MT-ND1","C-T","6","1","L-F","0.000%","0","1"3323,"MT-ND1","T-A","6","2","L-H","0.002%","1","1"3323,"MT-ND1","T-C","6","2","L-P","0.000%","0","1"3324,"MT-ND1","C-T","6","3","L-L","0.012%","7","1"3325,"MT-ND1","C-A","7","1","L-M","0.003%","2","1"3325,"MT-ND1","C-T","7","1","L-L","0.002%","1","1"3327,"MT-ND1","A-G","7","3","L-L","0.012%","7","1"3327,"MT-ND1","A-T","7","3","L-L","0.000%","0","1"3328,"MT-ND1","C-T","8","1","L-F","0.002%","1","1"3330,"MT-ND1","C-A","8","3","L-L","0.000%","0","1"3330,"MT-ND1","C-T","8","3","L-L","0.145%","86","1"3331,"MT-ND1","C-T","9","1","L-F","0.000%","0","1"3333,"MT-ND1","C-T","9","3","L-L","0.099%","59","10"3334,"MT-ND1","A-G","10","1","I-V","0.012%","7","1"3335,"MT-ND1","T-A","10","2","I-N","0.002%","1","1"3335,"MT-ND1","T-C","10","2","I-T","0.101%","60","4"3335,"MT-ND1","T-G","10","2","I-S","0.000%","0","1"3336,"MT-ND1","T-A","10","3","I-M","0.000%","0","1"3336,"MT-ND1","T-C","10","3","I-I","0.367% ","218","13"3337,"MT-ND1","G-A","11","1","V-M","0.153%","91","5"3337,"MT-ND1","G-C","11","1","V-L","0.000%","0","1"3337,"MT-ND1","G-T","11","1","V-L","0.003%","2","1"3338,"MT-ND1","T-A","11","2","V-E","0.007%","4","1"3338,"MT-ND1","T-C","11","2","V-A","0.190%","113","10"3339,"MT-ND1","A-G","11","3","V-V","0.029%","17","2"3339,"MT-ND1","A-T","11","3","V-V","0.000%","0","1"3340,"MT-ND1","C-T","12","1","P-S","0.000%","0","1"3342,"MT-ND1","C-A","12","3","P-P","0.000%","0","1"3342,"MT-ND1","C-T","12","3","P-P","0.071%","42","2"3343,"MT-ND1","A-G","13","1","I-V","0.005%","3","1"3344,"MT-ND1","T-C","13","2","I-T","0.000%","0","1"3345,"MT-ND1","T-C","13","3","I-I","0.039%","23","1"3346,"MT-ND1","C-A","14","1","L-M","0.002%","1","1"3346,"MT-ND1","C-T","14","1","L-L","0.002%","1","1"3347,"MT-ND1","T-C","14","2","L-P","0.002%","1","1"3348,"MT-ND1","A-G","14","3","L-L","0.625% ","371","12"3349,"MT-ND1","A-G","15","1","I-V","0.020%","12","3"3350,"MT-ND1","T-C","15","2","I-T","0.034%","20","3"3350,"MT-ND1","T-G","15","2","I-S","0.000%","0","1"3351,"MT-ND1","C-A","15","3","I-M","0.003%","2","1"3351,"MT-ND1","C-G","15","3","I-M","0.000%","0","1"3351,"MT-ND1","C-T","15","3","I-I","0.017%","10","4"3352,"MT-ND1","G-A","16","1","A-T","0.000%","0","1"3354,"MT-ND1","A-G","16","3","A-A","0.003%","2","1"3355,"MT-ND1","A-G","17","1","M-V","0.032%","19","1"3356,"MT-ND1","T-C","17","2","M-T","0.000%","0","1"3357,"MT-ND1","G-A","17","3","M-M","0.128%","76","2"3357,"MT-ND1","G-C","17","3","M-I","0.003%","2","1"3357,"MT-ND1","G-T","17","3","M-I","0.003%","2","1"3358,"MT-ND1","G-A","18","1","A-T","0.005%","3","1"3358,"MT-ND1","G-C","18","1","A-P","0.000%","0","1"3359,"MT-ND1","C-T","18","2","A-V","0.010%","6","1"3360,"MT-ND1","A-G","18","3","A-A","0.113%","67","3"3360,"MT-ND1","A-T","18","3","A-A","0.000%","0","1"3362,"MT-ND1","T-C","19","2","F-S","0.000%","0","1"3363,"MT-ND1","C-T","19","3","F-F","0.022%","13","2"3364,"MT-ND1","C-A","20","1","L-M","0.000%","0","1"3364,"MT-ND1","C-T","20","1","L-L","0.015%","9","1"3366,"MT-ND1","A-G","20","3","L-L","0.003%","2","1"3367,"MT-ND1","A-G","21","1","M-V","0.000%","0","1"3368,"MT-ND1","T-C","21","2","M-T","0.035%","21","1"3369,"MT-ND1","G-A","21","3","M-M","0.007%","4","1"3372,"MT-ND1","T-C","22","3","L-L","0.077%","46","2"3375,"MT-ND1","C-T","23","3","T-T","0.035%","21","1"3378,"MT-ND1","A-G","24","3","E-E","0.017%","10","2"3380,"MT-ND1","G-A","25","2","R-Q","0.005%","3","1"3381,"MT-ND1","A-G","25","3","R-R","0.012%","7","1"3384,"MT-ND1","A-G","26","3","K-K","0.172%","102","4"3385,"MT-ND1","A-C","27","1","I-L","0.000%","0","1"3385,"MT-ND1","A-G","27","1","I-V","0.020%","12","1"3385,"MT-ND1","A-T","27","1","I-F","0.002%","1","1"3386,"MT-ND1","T-C","27","2","I-T","0.003%","2","1"3387,"MT-ND1","T-A","27","3","I-M","0.003%","2","1"3387,"MT-ND1","T-C","27","3","I-I","0.008%","5","1"3387,"MT-ND1","T-G","27","3","I-M","0.002%","1","1"3388,"MT-ND1","C-A","28","1","L-M","0.051%","30","1"3388,"MT-ND1","C-T","28","1","L-L","0.000%","0","1"3390,"MT-ND1","A-G","28","3","L-L","0.017%","10","2"3391,"MT-ND1","G-A","29","1","G-S","0.091%","54","6"3392,"MT-ND1","G-A","29","2","G-D","0.002%","1","1"3392,"MT-ND1","G-C","29","2","G-A","0.017%","10","2"3393,"MT-ND1","C-A","29","3","G-G","0.002%","1","1"3393,"MT-ND1","C-T","29","3","G-G","0.002%","1","1"3394,"MT-ND1","T-C","30","1","Y-H","1.303% ","774","33"3395,"MT-ND1","A-C","30","2","Y-S","0.002%","1","1"3395,"MT-ND1","A-G","30","2","Y-C","0.045%","27","4"3396,"MT-ND1","T-C","30","3","Y-Y","0.761% ","452","8"3397,"MT-ND1","A-G","31","1","M-V","0.280% ","166","9"3398,"MT-ND1","T-C","31","2","M-T","0.431% ","256","12"3399,"MT-ND1","A-C","31","3","M-I","0.003%","2","1"3399,"MT-ND1","A-G","31","3","M-M","0.029%","17","2"3399,"MT-ND1","A-T","31","3","M-I","0.044%","26","1"3400,"MT-ND1","C-A","32","1","Q-K","0.002%","1","1"3402,"MT-ND1","A-G","32","3","Q-Q","0.012%","7","2"3403,"MT-ND1","C-T","33","1","L-L","0.005%","3","1"3405,"MT-ND1","A-G","33","3","L-L","0.008%","5","1"3405,"MT-ND1","A-T","33","3","L-L","0.000%","0","1"3407,"MT-ND1","G-A","34","2","R-H","0.002%","1","1"3408,"MT-ND1","C-A","34","3","R-R","0.000%","0","1"3408,"MT-ND1","C-T","34","3","R-R","0.007%","4","2"3410,"MT-ND1","A-T","35","2","K-M","0.003%","2","1"3411,"MT-ND1","A-G","35","3","K-K","0.020%","12","2"3414,"MT-ND1","C-T","36","3","G-G","0.012%","7","1"3416,"MT-ND1","C-A","37","2","P-H","0.000%","0","1"3417,"MT-ND1","C-A","37","3","P-P","0.000%","0","1"3417,"MT-ND1","C-T","37","3","P-P","0.015%","9","1"3418,"MT-ND1","A-G","38","1","N-D","0.002%","1","1"3419,"MT-ND1","A-G","38","2","N-S","0.000%","0","1"3420,"MT-ND1","C-T","38","3","N-N","0.039%","23","1"3421,"MT-ND1","G-A","39","1","V-I","0.135%","80","8"3422,"MT-ND1","T-C","39","2","V-A","0.000%","0","1"3422,"MT-ND1","T-G","39","2","V-G","0.002%","1","1"3423,"MT-ND1","T-A","39","3","V-V","1.014%","602","2"3423,"MT-ND1","T-C","39","3","V-V","0.113%","67","3"3423,"MT-ND1","T-G","39","3","V-V","0.034%","20","1"3424,"MT-ND1","G-C","40","1","V-L","0.000%","0","1"3424,"MT-ND1","G-T","40","1","V-L","0.000%","0","1"3426,"MT-ND1","A-C","40","3","V-V","0.002%","1","1"3426,"MT-ND1","A-G","40","3","V-V","0.012%","7","1"3426,"MT-ND1","A-T","40","3","V-V","0.000%","0","1"3427,"MT-ND1","G-A","41","1","G41S","0.000%","0","1"3429,"MT-ND1","C-T","41","3","G-G","0.008%","5","1"3431,"MT-ND1","C-T","42","2","P-L","0.002%","1","1"3432,"MT-ND1","C-T","42","3","P-P","0.035%","21","1"3433,"MT-ND1","T-C","43","1","Y-H","0.003%","2","1"3434,"MT-ND1","A-G","43","2","Y-C","0.783% ","465","14"3435,"MT-ND1","C-T","43","3","Y-Y","0.077%","46","2"3438,"MT-ND1","G-A","44","3","G-G","1.228% ","729","12"3438,"MT-ND1","G-C","44","3","G-G","0.002%","1","1"3438,"MT-ND1","G-T","44","3","G-G","0.000%","0","1"3439,"MT-ND1","C-T","45","1","L-L","0.003%","2","1"3441,"MT-ND1","A-G","45","3","L-L","0.025%","15","1"3441,"MT-ND1","A-T","45","3","L-L","0.000%","0","1"3442,"MT-ND1","C-T","46","1","L-L","0.015%","9","1"3444,"MT-ND1","A-G","46","3","L-L","0.003%","2","1"3444,"MT-ND1","A-T","46","3","L-L","0.003%","2","1"3447,"MT-ND1","A-C","47","3","Q-H","0.002%","1","1"3447,"MT-ND1","A-G","47","3","Q-Q","0.539% ","320","10"3448,"MT-ND1","C-G","48","1","P-A","0.000%","0","1"3450,"MT-ND1","C-A","48","3","P-P","0.000%","0","1"3450,"MT-ND1","C-T","48","3","P-P","0.726% ","431","3"3451,"MT-ND1","T-C","49","1","F-L","0.000%","0","1"3451,"MT-ND1","T-G","49","1","F-V","0.000%","0","1"3453,"MT-ND1","C-T","49","3","F-F","0.032%","19","2"3454,"MT-ND1","G-A","50","1","A-T","0.002%","1","1"3456,"MT-ND1","T-A","50","3","A-A","0.000%","0","1"3456,"MT-ND1","T-C","50","3","A-A","0.084%","50","2"3456,"MT-ND1","T-G","50","3","A-A","0.000%","0","1"3459,"MT-ND1","C-T","51","3","D-D","0.012%","7","1"3462,"MT-ND1","C-T","52","3","A-A","0.010%","6","1"3463,"MT-ND1","A-G","53","1","M-V","0.003%","2","1"3465,"MT-ND1","A-G","53","3","M-M","0.008%","5","1"3465,"MT-ND1","A-T","53","3","M-I","0.003%","2","2"3468,"MT-ND1","A-C","54","3","K-N","0.002%","1","1"3468,"MT-ND1","A-G","54","3","K-K","0.007%","4","1"3469,"MT-ND1","C-T","55","1","L-F","0.002%","1","1"3471,"MT-ND1","C-A","55","3","L-L","0.003%","2","1"3471,"MT-ND1","C-T","55","3","L-L","0.002%","1","1"3472,"MT-ND1","T-A","56","1","F-I","0.000%","0","1"3472,"MT-ND1","T-C","56","1","F-L","0.008%","5","0"3473,"MT-ND1","T-C","56","2","F-S","0.002%","1","1"3474,"MT-ND1","C-A","56","3","F-L","0.000%","0","1"3474,"MT-ND1","C-T","56","3","F-F","0.010%","6","1"3475,"MT-ND1","A-G","57","1","T-A","0.002%","1","1"3476,"MT-ND1","C-T","57","2","T-I","0.000%","0","1"3477,"MT-ND1","C-T","57","3","T-T","0.000%","0","1"3480,"MT-ND1","A-G","58","3","K-K","3.841% ","2281","25"3483,"MT-ND1","G-A","59","3","E-E","0.404% ","240","10"3483,"MT-ND1","G-C","59","3","E-D","0.003%","2","1"3486,"MT-ND1","C-A","60","3","P-P","0.000%","0","1"3486,"MT-ND1","C-T","60","3","P-P","0.037%","22","2"3487,"MT-ND1","C-A","61","1","L-M","0.002%","1","1"3487,"MT-ND1","C-T","61","1","L-L","0.039%","23","1"3488,"MT-ND1","T-A","61","2","L-Q","0.003%","2","1"3488,"MT-ND1","T-C","61","2","L-P","0.002%","1","0"3489,"MT-ND1","A-G","61","3","L-L","0.003%","2","1"3492,"MT-ND1","A-C","62","3","K-N","0.002%","1","1"3492,"MT-ND1","A-G","62","3","K-K","0.062%","37","1"3495,"MT-ND1","C-A","63","3","P-P","0.035%","21","2"3495,"MT-ND1","C-G","63","3","P-P","0.002%","1","1"3495,"MT-ND1","C-T","63","3","P-P","0.002%","1","1"3496,"MT-ND1","G-A","64","1","A-T","0.013%","8","1"3496,"MT-ND1","G-T","64","1","A-S","0.019%","11","4"3497,"MT-ND1","C-T","64","2","A-V","0.349% ","207","12"3498,"MT-ND1","C-A","64","3","A-A","0.002%","1","1"3498,"MT-ND1","C-G","64","3","A-A","0.210%","125","2"3498,"MT-ND1","C-T","64","3","A-A","0.093%","55","2"3499,"MT-ND1","A-G","65","1","T-A","0.000%","0","1"3499,"MT-ND1","A-T","65","1","T-S","0.002%","1","1"3500,"MT-ND1","C-T","65","2","T-M","0.000%","0","1"3501,"MT-ND1","A-G","65","3","T-T","0.003%","2","1"3504,"MT-ND1","T-A","66","3","S-S","0.000%","0","1"3504,"MT-ND1","T-C","66","3","S-S","0.113%","67","3"3504,"MT-ND1","T-G","66","3","S-S","0.000%","0","1"3505,"MT-ND1","A-G","67","1","T-A","1.384% ","822","14"3505,"MT-ND1","A-T","67","1","T-S","0.002%","1","1"3506,"MT-ND1","C-T","67","2","T-I","0.002%","1","1"3507,"MT-ND1","C-A","67","3","T-T","0.086%","51","2"3507,"MT-ND1","C-G","67","3","T-T","0.007%","4","1"3507,"MT-ND1","C-T","67","3","T-T","0.025%","15","4"3508,"MT-ND1","A-G","68","1","I-V","0.005%","3","1"3508,"MT-ND1","A-T","68","1","I-F","0.000%","0","1"3509,"MT-ND1","T-C","68","2","I-T","0.012%","7","1"3509,"MT-ND1","T-TAAGGGAGACCGCACATGACCCG","68","2","frameshift","0.000%","0","1"3510,"MT-ND1","C-A","68","3","I-M","0.012%","7","1"3510,"MT-ND1","C-G","68","3","I-M","0.000%","0","1"3510,"MT-ND1","C-T","68","3","I-I","0.025%","15","1"3511,"MT-ND1","A-G","69","1","T-A","0.096%","57","4"3511,"MT-ND1","A-T","69","1","T-S","0.003%","2","1"3513,"MT-ND1","C-A","69","3","T-T","0.002%","1","1"3513,"MT-ND1","C-T","69","3","T-T","0.109%","65","5"3514,"MT-ND1","C-T","70","1","L-F","0.002%","1","1"3516,"MT-ND1","C-A","70","3","L-L","2.844% ","1689","12"3516,"MT-ND1","C-T","70","3","L-L","0.007%","4","1"3519,"MT-ND1","C-T","71","3","Y-Y","0.025%","15","1"3520,"MT-ND1","A-G","72","1","I-V","0.007%","4","1"3521,"MT-ND1","T-C","72","2","I-T","0.000%","0","1"3522,"MT-ND1","C-T","72","3","I-I","0.015%","9","2"3523,"MT-ND1","A-G","73","1","T-A","0.067%","40","2"3523,"MT-ND1","A-T","73","1","T-S","0.047%","28","1"3524,"MT-ND1","C-T","73","2","T-I","0.000%","0","1"3525,"MT-ND1","C-A","73","3","T-T","0.047%","28","2"3525,"MT-ND1","C-T","73","3","T-T","0.066%","39","1"3526,"MT-ND1","G-A","74","1","A-T","0.005%","3","1"3527,"MT-ND1","C-G","74","2","A-G","0.002%","1","1"3528,"MT-ND1","C-T","74","3","A-A","0.064%","38","1"3531,"MT-ND1","G-A","75","3","P-P","0.465% ","276","12"3531,"MT-ND1","G-C","75","3","P-P","0.000%","0","1"3531,"MT-ND1","G-T","75","3","P-P","0.049%","29","1"3532,"MT-ND1","A-G","76","1","T-A","0.002%","1","1"3533,"MT-ND1","C-T","76","2","T-I","0.020%","12","3"3534,"MT-ND1","C-A","76","3","T-T","0.003%","2","1"3534,"MT-ND1","C-T","76","3","T-T","0.005%","3","1"3535,"MT-ND1","T-A","77","1","L-M","0.012%","7","2"3535,"MT-ND1","T-C","77","1","L-L","0.072%","43","3"3536,"MT-ND1","T-C","77","2","L-S","0.000%","0","1"3537,"MT-ND1","A-G","77","3","L-L","1.020% ","606","11"3540,"MT-ND1","T-A","78","3","A-A","0.002%","1","1"3540,"MT-ND1","T-C","78","3","A-A","0.140%","83","1"3540,"MT-ND1","T-G","78","3","A-A","0.002%","1","1"3541,"MT-ND1","C-T","79","1","L-F","0.008%","5","1"3543,"MT-ND1","C-A","79","3","L-L","0.000%","0","1"3543,"MT-ND1","C-G","79","3","L-L","0.000%","0","1"3543,"MT-ND1","C-T","79","3","L-L","0.039%","23","2"3546,"MT-ND1","C-A","80","3","T-T","0.175%","104","4"3546,"MT-ND1","C-T","80","3","T-T","0.071%","42","1"3547,"MT-ND1","A-C","81","1","I-L","0.002%","1","1"3547,"MT-ND1","A-G","81","1","I-V","1.904% ","1131","15"3548,"MT-ND1","T-C","81","2","I-T","0.059%","35","4"3549,"MT-ND1","C-T","81","3","I-I","0.099%","59","8"3550,"MT-ND1","G-A","82","1","A-T","0.000%","0","1"3552,"MT-ND1","T-A","82","3","A-A","3.501% ","2079","17"3552,"MT-ND1","T-C","82","3","A-A","0.256% ","152","7"3553,"MT-ND1","C-A","83","1","L-I","0.000%","0","1"3553,"MT-ND1","C-T","83","1","L-F","0.008%","5","1"3555,"MT-ND1","T-C","83","3","L-L","0.022%","13","2"3556,"MT-ND1","C-A","84","1","L-M","0.000%","0","1"3556,"MT-ND1","C-T","84","1","L-L","0.005%","3","1"3558,"MT-ND1","A-C","84","3","L-L","0.002%","1","1"3558,"MT-ND1","A-G","84","3","L-L","0.010%","6","1"3558,"MT-ND1","A-T","84","3","L-L","0.000%","0","1"3559,"MT-ND1","C-T","85","1","L-L","0.005%","3","1"3560,"MT-ND1","T-C","85","2","L-P","0.000%","0","1"3561,"MT-ND1","A-G","85","3","L-L","0.000%","0","1"3564,"MT-ND1","A-G","86","3","W-W","0.015%","9","1"3565,"MT-ND1","A-C","87","1","T-P","0.000%","0","1"3565,"MT-ND1","A-G","87","1","T-A","0.077%","46","2"3566,"MT-ND1","C-T","87","2","T-I","0.000%","0","1"3567,"MT-ND1","C-T","87","3","T-T","0.015%","9","1"3569,"MT-ND1","C-T","88","2","P88L","0.000%","0","1"3570,"MT-ND1","C-A","88","3","P-P","0.000%","0","1"3570,"MT-ND1","C-T","88","3","P-P","0.002%","1","1"3571,"MT-ND1","C-CC","89","1","frameshift","0.013%","8","1"3571,"MT-ND1","C-T","89","1","L-F","0.227%","135","7"3572,"MT-ND1","T-C","89","2","L-P","0.002%","1","1"3573,"MT-ND1","C-A","89","3","L-L","0.010%","6","1"3573,"MT-ND1","C-G","89","3","L-L","0.000%","0","1"3573,"MT-ND1","C-T","89","3","L-L","0.007%","4","1"3574,"MT-ND1","C-T","90","1","P-S","0.002%","1","1"3576,"MT-ND1","C-G","90","3","P-P","0.002%","1","1"3576,"MT-ND1","C-T","90","3","P-P","0.025%","15","2"3578,"MT-ND1","T-C","91","2","M-T","0.008%","5","1"3579,"MT-ND1","A-G","91","3","M-M","0.145%","86","2"3580,"MT-ND1","C-T","92","1","P-S","0.002%","1","1"3581,"MT-ND1","C-T","92","2","P-L","0.002%","1","1"3582,"MT-ND1","C-T","92","3","P-P","0.007%","4","2"3583,"MT-ND1","A-C","93","1","N-H","0.000%","0","1"3583,"MT-ND1","A-G","93","1","N-D","0.002%","1","1"3584,"MT-ND1","A-G","93","2","N-S","0.012%","7","1"3585,"MT-ND1","C-T","93","3","N-N","0.013%","8","1"3586,"MT-ND1","C-T","94","1","P-S","0.003%","2","1"3587,"MT-ND1","C-T","94","2","P-L","0.002%","1","1"3588,"MT-ND1","C-A","94","3","P-P","0.002%","1","1"3588,"MT-ND1","C-T","94","3","P-P","0.301% ","179","2"3589,"MT-ND1","C-G","95","1","L-V","0.002%","1","1"3589,"MT-ND1","C-T","95","1","L-L","0.005%","3","1"3590,"MT-ND1","T-C","95","2","L-P","0.000%","0","1"3591,"MT-ND1","G-A","95","3","L-L","0.773% ","459","10"3591,"MT-ND1","G-C","95","3","L-L","0.000%","0","1"3592,"MT-ND1","G-A","96","1","V-I","0.056%","33","2"3593,"MT-ND1","T-C","96","2","V-A","0.040%","24","4"3594,"MT-ND1","C-A","96","3","V-V","0.002%","1","1"3594,"MT-ND1","C-T","96","3","V-V","7.006% ","4161","31"3596,"MT-ND1","A-G","97","2","N-S","0.000%","0","1"3597,"MT-ND1","C-T","97","3","N-N","0.003%","2","1"3598,"MT-ND1","C-T","98","1","L-F","0.002%","1","1"3600,"MT-ND1","C-A","98","3","L-L","0.002%","1","1"3600,"MT-ND1","C-T","98","3","L-L","0.013%","8","1"3603,"MT-ND1","C-T","99","3","N-N","0.022%","13","2"3604,"MT-ND1","C-A","100","1","L-M","0.000%","0","1"3604,"MT-ND1","C-T","100","1","L-L","0.002%","1","3"3606,"MT-ND1","A-G","100","3","L-L","1.049% ","623","6"3607,"MT-ND1","G-A","101","1","G-S","0.000%","0","1"3608,"MT-ND1","G-A","101","2","G-D","0.002%","1","1"3608,"MT-ND1","G-C","101","2","G-A","0.000%","0","1"3609,"MT-ND1","C-G","101","3","G-G","0.000%","0","1"3609,"MT-ND1","C-T","101","3","G-G","0.008%","5","1"3612,"MT-ND1","C-T","102","3","L-L","0.012%","7","2"3613,"MT-ND1","C-A","103","1","L-M","0.000%","0","1"3613,"MT-ND1","C-T","103","1","L-L","0.022%","13","1"3614,"MT-ND1","T-C","103","2","L-P","0.000%","0","1"3615,"MT-ND1","A-G","103","3","L-L","0.093%","55","3"3618,"MT-ND1","T-C","104","3","F-F","0.362%","215","2"3621,"MT-ND1","T-C","105","3","I-I","0.125%","74","1"3622,"MT-ND1","C-A","106","1","L-M","0.000%","0","1"3622,"MT-ND1","C-T","106","1","L-L","0.003%","2","1"3624,"MT-ND1","A-C","106","3","L-L","0.000%","0","1"3624,"MT-ND1","A-G","106","3","L-L","0.022%","13","1"3627,"MT-ND1","C-A","107","3","A-A","0.000%","0","1"3627,"MT-ND1","C-T","107","3","A-A","0.012%","7","1"3628,"MT-ND1","A-G","108","1","T-A","0.003%","2","1"3628,"MT-ND1","A-T","108","1","T-S","0.000%","0","1"3630,"MT-ND1","C-A","108","3","T-T","0.000%","0","1"3630,"MT-ND1","C-T","108","3","T-T","0.184%","109","3"3632,"MT-ND1","C-T","109","2","S-F","0.000%","0","1"3633,"MT-ND1","T-C","109","3","S-S","0.035%","21","1"3633,"MT-ND1","T-G","109","3","S-S","0.000%","0","1"3636,"MT-ND1","C-T","110","3","S-S","0.000%","0","1"3637,"MT-ND1","C-A","111","1","L-M","0.002%","1","1"3637,"MT-ND1","C-T","111","1","L-L","0.008%","5","1"3639,"MT-ND1","A-G","111","3","L-L","0.022%","13","1"3640,"MT-ND1","G-A","112","1","A-T","0.019%","11","1"3640,"MT-ND1","G-C","112","1","A-P","0.000%","0","1"3642,"MT-ND1","C-T","112","3","A-A","0.000%","0","1"3643,"MT-ND1","G-A","113","1","V-I","0.000%","0","1"3644,"MT-ND1","T-C","113","2","V-A","0.384% ","228","13"3644,"MT-ND1","T-G","113","2","V-G","0.003%","2","2"3645,"MT-ND1","T-A","113","3","V-V","0.007%","4","1"3645,"MT-ND1","T-C","113","3","V-V","0.130%","77","3"3647,"MT-ND1","A-G","114","2","Y-C","0.000%","0","1"3648,"MT-ND1","C-T","114","3","Y-Y","0.007%","4","1"3651,"MT-ND1","A-G","115","3","S-S","0.003%","2","1"3651,"MT-ND1","A-T","115","3","S-S","0.002%","1","1"3652,"MT-ND1","A-G","116","1","I-V","0.008%","5","1"3653,"MT-ND1","T-A","116","2","I-N","0.002%","1","1"3653,"MT-ND1","T-C","116","2","I-T","0.000%","0","1"3654,"MT-ND1","C-T","116","3","I-I","0.074%","44","2"3655,"MT-ND1","C-A","117","1","L-I","0.000%","0","1"3657,"MT-ND1","C-A","117","3","L-L","0.005%","3","1"3657,"MT-ND1","C-G","117","3","L-L","0.000%","0","3"3657,"MT-ND1","C-T","117","3","L-L","0.003%","2","1"3660,"MT-ND1","A-G","118","3","W-W","0.015%","9","1"3661,"MT-ND1","T-G","119","1","S-A","0.002%","1","1"3663,"MT-ND1","A-C","119","3","S-S","0.002%","1","1"3663,"MT-ND1","A-G","119","3","S-S","0.069%","41","2"3666,"MT-ND1","G-A","120","3","G-G","2.095% ","1244","13"3666,"MT-ND1","G-C","120","3","G-G","0.003%","2","1"3669,"MT-ND1","A-G","121","3","W-W","0.034%","20","1"3672,"MT-ND1","A-G","122","3","A-A","0.143%","85","7"3672,"MT-ND1","A-T","122","3","A-A","0.005%","3","1"3674,"MT-ND1","C-T","123","2","S-L","0.000%","0","1"3675,"MT-ND1","A-G","123","3","S-S","0.007%","4","1"3676,"MT-ND1","A-C","124","1","N-H","0.003%","2","1"3678,"MT-ND1","C-T","124","3","N-N","0.002%","1","1"3681,"MT-ND1","A-T","125","3","S-S","0.000%","0","1"3684,"MT-ND1","C-A","126","3","N-K","0.002%","1","1"3684,"MT-ND1","C-T","126","3","N-N","0.002%","1","1"3687,"MT-ND1","C-T","127","3","Y-Y","0.064%","38","3"3688,"MT-ND1","G-C","128","1","A-P","0.024%","14","1"3690,"MT-ND1","C-G","128","3","A-A","0.000%","0","1"3690,"MT-ND1","C-T","128","3","A-A","0.003%","2","1"3691,"MT-ND1","C-T","129","1","L-L","0.010%","6","1"3693,"MT-ND1","G-A","129","3","L-L","0.833% ","495","6"3693,"MT-ND1","G-C","129","3","L-L","0.013%","8","1"3693,"MT-ND1","G-T","129","3","L-L","0.000%","0","1"3694,"MT-ND1","A-G","130","1","I-V","0.000%","0","1"3696,"MT-ND1","C-T","130","3","I-I","0.020%","12","3"3697,"MT-ND1","G-T","131","1","G-C","0.000%","0","1"3699,"MT-ND1","C-G","131","3","G-G","0.034%","20","1"3699,"MT-ND1","C-T","131","3","G-G","0.017%","10","1"3701,"MT-ND1","C-T","132","2","A-V","0.000%","0","1"3702,"MT-ND1","A-G","132","3","A-A","0.030%","18","2"3703,"MT-ND1","C-T","133","1","L-L","0.002%","1","1"3704,"MT-ND1","T-C","133","2","L-P","0.000%","0","1"3705,"MT-ND1","G-A","133","3","L-L","1.197% ","711","11"3705,"MT-ND1","G-C","133","3","L-L","0.002%","1","1"3708,"MT-ND1","A-G","134","3","R-R","0.012%","7","1"3709,"MT-ND1","G-A","135","1","A-T","0.000%","0","1"3710,"MT-ND1","C-T","135","2","A-V","0.002%","1","1"3711,"MT-ND1","A-C","135","3","A-A","0.000%","0","1"3711,"MT-ND1","A-G","135","3","A-A","0.005%","3","1"3712,"MT-ND1","G-A","136","1","V-M","0.000%","0","1"3713,"MT-ND1","T-C","136","2","V-A","0.000%","0","1"3714,"MT-ND1","A-C","136","3","V-V","0.003%","2","1"3714,"MT-ND1","A-G","136","3","V-V","0.274% ","163","6"3714,"MT-ND1","A-T","136","3","V-V","0.000%","0","1"3715,"MT-ND1","G-A","137","1","A-T","0.000%","0","1"3715,"MT-ND1","G-C","137","1","A-P","0.000%","0","1"3717,"MT-ND1","C-T","137","3","A-A","0.002%","1","1"3720,"MT-ND1","A-G","138","3","Q-Q","0.674% ","400","10"3720,"MT-ND1","A-T","138","3","Q-H","0.002%","1","1"3721,"MT-ND1","A-G","139","1","T-A","0.027%","16","1"3722,"MT-ND1","C-T","139","2","T-M","0.000%","0","1"3723,"MT-ND1","A-G","139","3","T-T","0.005%","3","1"3724,"MT-ND1","A-G","140","1","I-V","0.000%","0","1"3727,"MT-ND1","T-TCAG","141","1","S-SA","0.000%","0","1"3729,"MT-ND1","A-C","141","3","S-S","0.008%","5","1"3729,"MT-ND1","A-G","141","3","S-S","0.010%","6","2"3732,"MT-ND1","T-C","142","3","Y-Y","0.040%","24","1"3734,"MT-ND1","A-G","143","2","E-G","0.000%","0","1"3735,"MT-ND1","A-G","143","3","E-E","0.003%","2","1"3736,"MT-ND1","G-A","144","1","V-I","0.182%","108","4"3737,"MT-ND1","T-C","144","2","V-A","0.000%","0","1"3738,"MT-ND1","C-G","144","3","V-V","0.000%","0","1"3738,"MT-ND1","C-T","144","3","V-V","0.200% ","119","9"3739,"MT-ND1","A-G","145","1","T-A","0.000%","0","1"3740,"MT-ND1","C-T","145","2","T-I","0.000%","0","1"3741,"MT-ND1","C-T","145","3","T-T","0.778% ","462","3"3742,"MT-ND1","C-A","146","1","L-M","0.000%","0","1"3742,"MT-ND1","C-T","146","1","L-L","0.002%","1","1"3744,"MT-ND1","A-C","146","3","L-L","0.000%","0","1"3744,"MT-ND1","A-G","146","3","L-L","0.141%","84","3"3745,"MT-ND1","G-A","147","1","A-T","0.185%","110","7"3745,"MT-ND1","G-T","147","1","A-S","0.000%","0","1"3746,"MT-ND1","C-T","147","2","A-V","0.034%","20","5"3747,"MT-ND1","C-A","147","3","A-A","0.000%","0","1"3747,"MT-ND1","C-T","147","3","A-A","0.010%","6","1"3749,"MT-ND1","T-C","148","2","I-T","0.000%","0","1"3750,"MT-ND1","C-T","148","3","I-I","0.034%","20","1"3751,"MT-ND1","A-G","149","1","I-V","0.000%","0","1"3752,"MT-ND1","T-C","149","2","I-T","0.000%","0","1"3753,"MT-ND1","T-A","149","3","I-M","0.000%","0","1"3753,"MT-ND1","T-C","149","3","I-I","0.091%","54","2"3754,"MT-ND1","C-T","150","1","L-L","0.008%","5","1"3756,"MT-ND1","A-G","150","3","L-L","1.261% ","749","1"3756,"MT-ND1","A-T","150","3","L-L","0.002%","1","1"3757,"MT-ND1","C-T","151","1","L-L","0.008%","5","1"3759,"MT-ND1","A-G","151","3","L-L","0.052%","31","4"3760,"MT-ND1","T-A","152","1","S-T","0.000%","0","1"3760,"MT-ND1","T-G","152","1","S-A","0.015%","9","1"3762,"MT-ND1","A-C","152","3","S-S","0.002%","1","1"3762,"MT-ND1","A-G","152","3","S-S","0.003%","2","1"3763,"MT-ND1","A-G","153","1","T-A","0.007%","4","1"3764,"MT-ND1","C-T","153","2","T-M","0.008%","5","1"3765,"MT-ND1","A-G","153","3","T-T","0.005%","3","1"3766,"MT-ND1","T-C","154","1","L-L","0.077%","46","3"3768,"MT-ND1","A-G","154","3","L-L","0.167%","99","3"3769,"MT-ND1","C-T","155","1","L-L","0.007%","4","1"3771,"MT-ND1","A-G","155","3","L-L","0.002%","1","1"3772,"MT-ND1","A-C","156","1","M-L","0.000%","0","1"3772,"MT-ND1","A-G","156","1","M-V","0.000%","0","1"3773,"MT-ND1","T-C","156","2","M-T","0.000%","0","1"3774,"MT-ND1","A-G","156","3","M-M","0.002%","1","1"3775,"MT-ND1","A-T","157","1","S157C","0.000%","0","1"3776,"MT-ND1","G-A","157","2","S-N","0.005%","3","1"3776,"MT-ND1","G-C","157","2","S-T","0.000%","0","1"3777,"MT-ND1","T-C","157","3","S-S","0.148%","88","4"3780,"MT-ND1","C-A","158","3","G-G","0.002%","1","1"3780,"MT-ND1","C-T","158","3","G-G","0.074%","44","3"3781,"MT-ND1","T-C","159","1","S-P","0.000%","0","1"3783,"MT-ND1","C-A","159","3","S-S","0.002%","1","2"3783,"MT-ND1","C-T","159","3","S-S","0.002%","1","1"3784,"MT-ND1","T-C","160","1","F-L","0.002%","1","1"3785,"MT-ND1","T-A","160","2","F-Y","0.000%","0","1"3786,"MT-ND1","T-C","160","3","F-F","0.037%","22","1"3787,"MT-ND1","A-G","161","1","N-D","0.000%","0","1"3788,"MT-ND1","A-C","161","2","N-T","0.000%","0","1"3788,"MT-ND1","A-G","161","2","N-S","0.005%","3","1"3789,"MT-ND1","C-T","161","3","N-N","0.008%","5","1"3790,"MT-ND1","C-A","162","1","L-I","0.000%","0","1"3790,"MT-ND1","C-T","162","1","L-F","0.000%","0","1"3791,"MT-ND1","T-C","162","2","L-P","0.000%","0","1"3792,"MT-ND1","C-A","162","3","L-L","0.000%","0","1"3792,"MT-ND1","C-T","162","3","L-L","0.008%","5","2"3793,"MT-ND1","T-C","163","1","S-P","0.000%","0","1"3795,"MT-ND1","C-A","163","3","S-S","0.000%","0","1"3795,"MT-ND1","C-T","163","3","S-S","0.015%","9","1"3796,"MT-ND1","A-G","164","1","T-A","0.470% ","279","14"3796,"MT-ND1","A-T","164","1","T-S","0.349%","207","3"3797,"MT-ND1","C-G","164","2","T-S","0.002%","1","1"3798,"MT-ND1","C-A","164","3","T-T","0.000%","0","1"3798,"MT-ND1","C-T","164","3","T-T","0.022%","13","1"3800,"MT-ND1","T-C","165","2","L-P","0.000%","0","1"3801,"MT-ND1","T-C","165","3","L-L","0.019%","11","3"3802,"MT-ND1","A-G","166","1","I-V","0.008%","5","1"3803,"MT-ND1","T-C","166","2","I-T","0.003%","2","1"3803,"MT-ND1","T-G","166","2","I-S","0.007%","4","1"3804,"MT-ND1","C-T","166","3","I-I","0.003%","2","1"3805,"MT-ND1","A-G","167","1","T-A","0.002%","1","1"3806,"MT-ND1","C-T","167","2","T-M","0.002%","1","1"3807,"MT-ND1","A-G","167","3","T-T","0.000%","0","1"3808,"MT-ND1","A-G","168","1","T-A","0.039%","23","2"3810,"MT-ND1","A-G","168","3","T-T","0.003%","2","1"3813,"MT-ND1","A-G","169","3","Q-Q","0.013%","8","1"3816,"MT-ND1","A-G","170","3","E-E","0.482% ","286","6"3817,"MT-ND1","C-T","171","1","H-Y","0.025%","15","2"3819,"MT-ND1","C-T","171","3","H-H","0.128%","76","4"3820,"MT-ND1","C-T","172","1","L-F","0.003%","2","1"3821,"MT-ND1","T-C","172","2","L-P","0.000%","0","1"3822,"MT-ND1","C-A","172","3","L-L","0.002%","1","1"3822,"MT-ND1","C-T","172","3","L-L","0.002%","1","1"3825,"MT-ND1","A-G","173","3","W-W","0.003%","2","1"3826,"MT-ND1","T-C","174","1","L-L","0.145%","86","3"3828,"MT-ND1","A-G","174","3","L-L","0.072%","43","3"3831,"MT-ND1","C-A","175","3","L-L","0.003%","2","1"3831,"MT-ND1","C-T","175","3","L-L","0.007%","4","1"3832,"MT-ND1","C-A","176","1","L-M","0.007%","4","1"3832,"MT-ND1","C-T","176","1","L-L","0.002%","1","1"3834,"MT-ND1","G-A","176","3","L-L","0.881% ","523","15"3834,"MT-ND1","G-C","176","3","L-L","0.015%","9","1"3837,"MT-ND1","A-C","177","3","P-P","0.002%","1","1"3837,"MT-ND1","A-G","177","3","P-P","0.002%","1","1"3838,"MT-ND1","T-A","178","1","S-T","0.002%","1","1"3838,"MT-ND1","T-G","178","1","S-A","0.000%","0","1"3839,"MT-ND1","C-A","178","2","S-Term","0.002%","1","1"3839,"MT-ND1","C-T","178","2","S-L","0.002%","1","1"3840,"MT-ND1","A-C","178","3","S-S","0.000%","0","1"3840,"MT-ND1","A-G","178","3","S-S","0.040%","24","1"3840,"MT-ND1","A-T","178","3","S-S","0.000%","0","1"3843,"MT-ND1","A-G","179","3","W-W","0.360%","214","5"3845,"MT-ND1","C-T","180","2","P-L","0.002%","1","1"3846,"MT-ND1","C-T","180","3","P-P","0.003%","2","1"3847,"MT-ND1","T-C","181","1","L-L","0.571% ","339","10"3849,"MT-ND1","G-A","181","3","L-L","0.374% ","222","12"3850,"MT-ND1","G-A","182","1","A-T","0.000%","0","1"3850,"MT-ND1","G-C","182","1","A-P","0.002%","1","1"3850,"MT-ND1","G-T","182","1","A-S","0.002%","1","1"3851,"MT-ND1","C-T","182","2","A-V","0.002%","1","1"3852,"MT-ND1","C-T","182","3","A-A","0.051%","30","1"3855,"MT-ND1","A-G","183","3","M-M","0.002%","1","1"3856,"MT-ND1","A-G","184","1","M-V","0.000%","0","1"3858,"MT-ND1","A-G","184","3","M-M","0.005%","3","1"3861,"MT-ND1","A-G","185","3","W-W","0.187%","111","1"3862,"MT-ND1","T-C","186","1","F-L","0.000%","0","1"3864,"MT-ND1","T-C","186","3","F-F","0.010%","6","1"3865,"MT-ND1","A-G","187","1","I-V","0.074%","44","3"3866,"MT-ND1","T-C","187","2","I-T","0.274%","163","10"3866,"MT-ND1","T-G","187","2","I-S","0.002%","1","1"3867,"MT-ND1","C-T","187","3","I-I","0.057%","34","2"3870,"MT-ND1","C-A","188","3","S-S","0.002%","1","1"3870,"MT-ND1","C-T","188","3","S-S","0.005%","3","1"3871,"MT-ND1","A-G","189","1","T-A","0.000%","0","1"3873,"MT-ND1","A-C","189","3","T-T","0.002%","1","1"3873,"MT-ND1","A-G","189","3","T-T","0.062%","37","2"3874,"MT-ND1","C-T","190","1","L-L","0.012%","7","1"3876,"MT-ND1","A-G","190","3","L-L","0.005%","3","1"3879,"MT-ND1","A-G","191","3","A-A","0.019%","11","1"3882,"MT-ND1","G-A","192","3","E-E","0.411% ","244","10"3885,"MT-ND1","C-T","193","3","T-T","0.000%","0","1"3887,"MT-ND1","A-G","194","2","N-S","0.000%","0","1"3887,"MT-ND1","A-T","194","2","N-I","0.002%","1","1"3888,"MT-ND1","C-T","194","3","N-N","0.002%","1","1"3891,"MT-ND1","A-G","195","3","R-R","0.008%","5","1"3892,"MT-ND1","A-C","196","1","T-P","0.000%","0","1"3892,"MT-ND1","A-G","196","1","T-A","0.057%","34","1"3892,"MT-ND1","A-T","196","1","T-S","0.002%","1","1"3893,"MT-ND1","C-T","196","2","T-I","0.000%","0","1"3894,"MT-ND1","C-G","196","3","T-T","0.000%","0","1"3894,"MT-ND1","C-T","196","3","T-T","0.022%","13","2"3897,"MT-ND1","C-A","197","3","P-P","0.010%","6","1"3897,"MT-ND1","C-T","197","3","P-P","0.042%","25","2"3900,"MT-ND1","C-T","198","3","F-F","0.003%","2","1"3901,"MT-ND1","G-A","199","1","D-N","0.003%","2","1"3902,"MT-ND1","A-G","199","2","D-G","0.002%","1","1"3903,"MT-ND1","C-T","199","3","D-D","0.022%","13","1"3904,"MT-ND1","C-A","200","1","L-I","0.000%","0","1"3906,"MT-ND1","T-A","200","3","L-L","0.015%","9","2"3906,"MT-ND1","T-C","200","3","L-L","0.025%","15","2"3907,"MT-ND1","G-A","201","1","A-T","0.007%","4","1"3907,"MT-ND1","G-C","201","1","A-P","0.000%","0","1"3908,"MT-ND1","C-G","201","2","A-G","0.002%","1","1"3909,"MT-ND1","C-T","201","3","A-A","0.010%","6","1"3910,"MT-ND1","G-A","202","1","E-K","0.002%","1","1"3912,"MT-ND1","A-G","202","3","E-E","0.057%","34","1"3914,"MT-ND1","G-A","203","2","G-E","0.002%","1","1"3915,"MT-ND1","G-A","203","3","G-G","1.133% ","673","25"3915,"MT-ND1","G-C","203","3","G-G","0.002%","1","1"3915,"MT-ND1","G-T","203","3","G-G","0.000%","0","1"3918,"MT-ND1","G-A","204","3","E-E","0.850% ","505","9"3918,"MT-ND1","G-C","204","3","E-D","0.000%","0","1"3919,"MT-ND1","T-C","205","1","S-P","0.000%","0","1"3920,"MT-ND1","C-T","205","2","S-F","0.002%","1","1"3921,"MT-ND1","C-A","205","3","S-S","0.261% ","155","4"3921,"MT-ND1","C-G","205","3","S-S","0.000%","0","1"3921,"MT-ND1","C-T","205","3","S-S","0.278% ","165","6"3922,"MT-ND1","G-A","206","1","E-K","0.002%","1","1"3924,"MT-ND1","A-G","206","3","E-E","0.003%","2","1"3925,"MT-ND1","C-T","207","1","L-L","0.000%","0","1"3927,"MT-ND1","A-G","207","3","L-L","0.098%","58","4"3928,"MT-ND1","G-A","208","1","V-I","0.000%","0","1"3928,"MT-ND1","G-C","208","1","V208L","0.000%","0","1"3930,"MT-ND1","C-A","208","3","V-V","0.003%","2","1"3930,"MT-ND1","C-T","208","3","V-V","0.022%","13","1"3933,"MT-ND1","A-C","209","3","S-S","0.000%","0","1"3933,"MT-ND1","A-G","209","3","S-S","0.003%","2","2"3935,"MT-ND1","G-A","210","2","G-D","0.003%","2","1"3936,"MT-ND1","C-A","210","3","G-G","0.002%","1","1"3936,"MT-ND1","C-G","210","3","G-G","0.002%","1","1"3936,"MT-ND1","C-T","210","3","G-G","0.025%","15","4"3937,"MT-ND1","T-C","211","1","F-L","0.000%","0","1"3939,"MT-ND1","C-T","211","3","F-F","0.003%","2","1"3941,"MT-ND1","A-G","212","2","N-S","0.000%","0","1"3942,"MT-ND1","C-T","212","3","N-N","0.005%","3","1"3943,"MT-ND1","A-G","213","1","I-V","0.015%","9","1"3944,"MT-ND1","T-C","213","2","I-T","0.012%","7","1"3945,"MT-ND1","C-G","213","3","I-M","0.002%","1","1"3945,"MT-ND1","C-T","213","3","I-I","0.045%","27","1"3946,"MT-ND1","G-A","214","1","E-K","0.000%","0","1"3948,"MT-ND1","A-G","214","3","E-E","0.074%","44","4"3949,"MT-ND1","T-C","215","1","Y-H","0.002%","1","1"3951,"MT-ND1","C-T","215","3","Y-Y","0.005%","3","1"3952,"MT-ND1","G-A","216","1","A-T","0.002%","1","1"3952,"MT-ND1","G-T","216","1","A-S","0.000%","0","1"3954,"MT-ND1","C-T","216","3","A-A","0.088%","52","2"3957,"MT-ND1","A-G","217","3","A-A","0.012%","7","1"3957,"MT-ND1","A-T","217","3","A-A","0.002%","1","1"3960,"MT-ND1","C-A","218","3","G-G","0.000%","0","1"3960,"MT-ND1","C-T","218","3","G-G","0.017%","10","2"3961,"MT-ND1","C-T","219","1","P-S","0.000%","0","1"3963,"MT-ND1","C-A","219","3","P-P","0.002%","1","1"3963,"MT-ND1","C-T","219","3","P-P","0.002%","1","1"3966,"MT-ND1","C-T","220","3","F-F","0.008%","5","1"3967,"MT-ND1","G-A","221","1","A-T","0.000%","0","1"3967,"MT-ND1","G-T","221","1","A-S","0.000%","0","1"3969,"MT-ND1","C-T","221","3","A-A","0.069%","41","2"3970,"MT-ND1","C-T","222","1","L-L","3.590% ","2132","33"3972,"MT-ND1","A-G","222","3","L-L","0.042%","25","2"3973,"MT-ND1","T-C","223","1","F-L","0.000%","0","1"3975,"MT-ND1","C-T","223","3","F-F","0.025%","15","1"3976,"MT-ND1","T-C","224","1","F-L","0.000%","0","1"3978,"MT-ND1","C-T","224","3","F-F","0.005%","3","1"3979,"MT-ND1","A-G","225","1","M-V","0.000%","0","1"3981,"MT-ND1","A-G","225","3","M-M","0.411%","244","3"3982,"MT-ND1","G-A","226","1","A-T","0.000%","0","1"3984,"MT-ND1","C-T","226","3","A-A","0.024%","14","1"3987,"MT-ND1","A-G","227","3","E-E","0.024%","14","1"3990,"MT-ND1","C-T","228","3","Y-Y","0.322% ","191","6"3991,"MT-ND1","A-G","229","1","T-A","0.002%","1","1"3991,"MT-ND1","A-T","229","1","T-S","0.000%","0","1"3992,"MT-ND1","C-T","229","2","T-M","0.709% ","421","17"3993,"MT-ND1","A-G","229","3","T-T","0.000%","0","1"3993,"MT-ND1","A-T","229","3","T-T","0.003%","2","1"3994,"MT-ND1","A-C","230","1","N-H","0.002%","1","1"3994,"MT-ND1","A-G","230","1","N-D","0.002%","1","1"3995,"MT-ND1","A-C","230","2","N-T","0.008%","5","1"3995,"MT-ND1","A-G","230","2","N-S","0.030%","18","0"3996,"MT-ND1","C-T","230","3","N-N","0.025%","15","2"3999,"MT-ND1","T-C","231","3","I-I","0.079%","47","3"4000,"MT-ND1","A-C","232","1","I-L","0.003%","2","1"4000,"MT-ND1","A-G","232","1","I-V","0.000%","0","1"4002,"MT-ND1","T-C","232","3","I-I","0.029%","17","1"4004,"MT-ND1","T-C","233","2","M-T","0.002%","1","1"4005,"MT-ND1","A-G","233","3","M-M","0.010%","6","1"4008,"MT-ND1","A-G","234","3","M-M","0.019%","11","1"4008,"MT-ND1","A-T","234","3","M-I","0.000%","0","1"4011,"MT-ND1","C-T","235","3","N-N","0.072%","43","5"4012,"MT-ND1","A-G","236","1","T-A","0.096%","57","4"4012,"MT-ND1","A-T","236","1","T-S","0.000%","0","1"4013,"MT-ND1","C-G","236","2","T-S","0.000%","0","1"4013,"MT-ND1","C-T","236","2","T-I","0.040%","24","2"4014,"MT-ND1","C-G","236","3","T-T","0.000%","0","1"4014,"MT-ND1","C-T","236","3","T-T","0.012%","7","1"4015,"MT-ND1","C-T","237","1","L-F","0.007%","4","1"4017,"MT-ND1","C-A","237","3","L-L","0.010%","6","1"4017,"MT-ND1","C-T","237","3","L-L","0.133%","79","2"4020,"MT-ND1","C-A","238","3","T-T","0.000%","0","1"4020,"MT-ND1","C-T","238","3","T-T","0.035%","21","2"4021,"MT-ND1","A-G","239","1","T-A","0.071%","42","2"4021,"MT-ND1","A-T","239","1","T-S","0.002%","1","1"4022,"MT-ND1","C-T","239","2","T-I","0.000%","0","1"4023,"MT-ND1","T-C","239","3","T-T","0.094%","56","6"4023,"MT-ND1","T-G","239","3","T-T","0.002%","1","1"4024,"MT-ND1","A-G","240","1","T-A","0.566% ","336","15"4024,"MT-ND1","A-T","240","1","T-S","0.003%","2","2"4025,"MT-ND1","C-T","240","2","T-M","0.719% ","427","10"4026,"MT-ND1","A-G","240","3","T-T","0.084%","50","3"4026,"MT-ND1","A-T","240","3","T-T","0.003%","2","1"4029,"MT-ND1","C-A","241","3","I-M","0.032%","19","2"4029,"MT-ND1","C-T","241","3","I-I","0.012%","7","1"4031,"MT-ND1","T-C","242","2","F-S","0.002%","1","1"4032,"MT-ND1","C-T","242","3","F-F","0.013%","8","1"4033,"MT-ND1","C-A","243","1","L-M","0.002%","1","1"4033,"MT-ND1","C-T","243","1","L-L","0.000%","0","1"4035,"MT-ND1","A-G","243","3","L-L","0.008%","5","1"4036,"MT-ND1","G-A","244","1","G-Term","0.003%","2","1"4038,"MT-ND1","A-G","244","3","G-G","0.106%","63","1"4039,"MT-ND1","A-G","245","1","T-A","0.000%","0","1"4039,"MT-ND1","A-T","245","1","T-S","0.000%","0","1"4040,"MT-ND1","C-G","245","2","T-Term","0.000%","0","1"4040,"MT-ND1","C-T","245","2","T-M","0.002%","1","1"4041,"MT-ND1","A-G","245","3","T-T","0.000%","0","1"4042,"MT-ND1","A-G","246","1","T-A","0.000%","0","1"4043,"MT-ND1","C-T","246","2","T-M","0.000%","0","1"4044,"MT-ND1","A-G","246","3","T-T","0.411%","244","1"4047,"MT-ND1","T-C","247","3","Y-Y","0.148%","88","4"4048,"MT-ND1","G-A","248","1","D-N","1.561% ","927","31"4048,"MT-ND1","G-C","248","1","D-H","0.000%","0","1"4049,"MT-ND1","A-G","248","2","D-G","0.000%","0","1"4050,"MT-ND1","C-T","248","3","D-D","0.029%","17","2"4051,"MT-ND1","G-A","249","1","A-T","0.002%","1","1"4052,"MT-ND1","C-T","249","2","A-V","0.029%","17","3"4053,"MT-ND1","A-C","249","3","A-A","0.003%","2","1"4053,"MT-ND1","A-G","249","3","A-A","0.051%","30","1"4053,"MT-ND1","A-T","249","3","A-A","0.003%","2","1"4054,"MT-ND1","C-T","250","1","L-F","0.000%","0","1"4055,"MT-ND1","T-A","250","2","L-H","0.000%","0","1"4055,"MT-ND1","T-C","250","2","L-P","0.000%","0","1"4056,"MT-ND1","C-A","250","3","L-L","0.002%","1","1"4056,"MT-ND1","C-T","250","3","L-L","0.013%","8","1"4058,"MT-ND1","C-G","251","2","S-C","0.000%","0","1"4058,"MT-ND1","C-T","251","2","S-F","0.000%","0","1"4059,"MT-ND1","C-A","251","3","S-S","0.003%","2","1"4059,"MT-ND1","C-T","251","3","S-S","0.096%","57","6"4061,"MT-ND1","C-A","252","2","P-H","0.000%","0","1"4062,"MT-ND1","T-C","252","3","P-P","0.062%","37","3"4062,"MT-ND1","T-G","252","3","P-P","0.000%","0","1"4063,"MT-ND1","G-A","253","1","E-K","0.002%","1","1"4064,"MT-ND1","A-G","253","2","E-G","0.000%","0","1"4065,"MT-ND1","A-G","253","3","E-E","0.037%","22","4"4066,"MT-ND1","C-CCTG","254","1","L-PV","0.000%","0","1"4068,"MT-ND1","C-A","254","3","L-L","0.000%","0","1"4068,"MT-ND1","C-T","254","3","L-L","0.003%","2","1"4069,"MT-ND1","T-C","255","1","Y-H","0.000%","0","1"4070,"MT-ND1","A-G","255","2","Y-C","0.000%","0","1"4071,"MT-ND1","C-T","255","3","Y-Y","2.455% ","1458","31"4072,"MT-ND1","A-G","256","1","T-A","0.000%","0","1"4074,"MT-ND1","A-G","256","3","T-T","0.005%","3","1"4074,"MT-ND1","A-T","256","3","T-T","0.000%","0","1"4075,"MT-ND1","A-G","257","1","T-A","0.000%","0","1"4076,"MT-ND1","C-T","257","2","T-M","0.003%","2","1"4077,"MT-ND1","A-G","257","3","T-T","0.000%","0","1"4077,"MT-ND1","ATATT-del","257","3","frameshift","0.000%","0","1"4078,"MT-ND1","T-C","258","1","Y-H","0.000%","0","1"4079,"MT-ND1","A-G","258","2","Y-C","0.042%","25","2"4080,"MT-ND1","T-C","258","3","Y-Y","0.138%","82","4"4081,"MT-ND1","T-C","259","1","F-L","0.002%","1","1"4082,"MT-ND1","T-C","259","2","F-S","0.002%","1","1"4082,"MT-ND1","T-G","259","2","F-C","0.000%","0","2"4083,"MT-ND1","T-C","259","3","F-F","0.022%","13","1"4083,"MT-ND1","T-G","259","3","F-L","0.000%","0","2"4084,"MT-ND1","G-A","260","1","V-I","0.037%","22","1"4085,"MT-ND1","T-C","260","2","V-A","0.000%","0","1"4086,"MT-ND1","C-T","260","3","V-V","1.435% ","852","14"4087,"MT-ND1","A-G","261","1","T-A","0.008%","5","1"4088,"MT-ND1","C-T","261","2","T-I","0.008%","5","1"4089,"MT-ND1","C-A","261","3","T-T","0.002%","1","1"4089,"MT-ND1","C-T","261","3","T-T","0.003%","2","1"4092,"MT-ND1","G-A","262","3","K-K","0.242%","144","4"4093,"MT-ND1","A-G","263","1","T-A","0.320% ","190","7"4093,"MT-ND1","A-T","263","1","T-S","0.000%","0","1"4094,"MT-ND1","C-T","263","2","T-I","0.019%","11","1"4095,"MT-ND1","C-T","263","3","T-T","0.015%","9","1"4096,"MT-ND1","C-T","264","1","L-L","0.007%","4","1"4098,"MT-ND1","A-G","264","3","L-L","0.017%","10","2"4099,"MT-ND1","C-T","265","1","L-F","0.037%","22","3"4100,"MT-ND1","T-C","265","2","L-P","0.000%","0","1"4101,"MT-ND1","T-C","265","3","L-L","0.027%","16","1"4102,"MT-ND1","C-A","266","1","L-M","0.019%","11","1"4102,"MT-ND1","C-T","266","1","L-L","0.025%","15","1"4104,"MT-ND1","A-G","266","3","L-L","6.974% ","4142","19"4104,"MT-ND1","A-T","266","3","L-L","0.000%","0","1"4105,"MT-ND1","A-G","267","1","T-A","0.002%","1","1"4106,"MT-ND1","C-G","267","2","T-S","0.000%","0","1"4106,"MT-ND1","C-T","267","2","T-I","0.002%","1","1"4107,"MT-ND1","C-A","267","3","T-T","0.000%","0","1"4107,"MT-ND1","C-T","267","3","T-T","0.049%","29","2"4108,"MT-ND1","T-G","268","1","S-A","0.000%","0","1"4109,"MT-ND1","C-T","268","2","S-F","0.007%","4","1"4110,"MT-ND1","C-A","268","3","S-S","0.000%","0","1"4110,"MT-ND1","C-T","268","3","S-S","0.003%","2","1"4111,"MT-ND1","C-T","269","1","L-L","0.003%","2","1"4113,"MT-ND1","G-A","269","3","L-L","0.246% ","146","5"4113,"MT-ND1","G-C","269","3","L-L","0.003%","2","1"4114,"MT-ND1","T-C","270","1","F-L","0.002%","1","1"4116,"MT-ND1","C-T","270","3","F-F","0.007%","4","1"4117,"MT-ND1","T-A","271","1","L-M","0.000%","0","1"4117,"MT-ND1","T-C","271","1","L-L","0.828% ","492","8"4118,"MT-ND1","T-C","271","2","L-S","0.003%","2","1"4119,"MT-ND1","A-G","271","3","L-L","0.002%","1","1"4122,"MT-ND1","A-G","272","3","W-W","0.177%","105","6"4123,"MT-ND1","A-G","273","1","I-V","0.074%","44","4"4124,"MT-ND1","T-C","273","2","I-T","0.000%","0","1"4125,"MT-ND1","T-C","273","3","I-I","0.003%","2","1"4128,"MT-ND1","A-G","274","3","R-R","0.000%","0","1"4128,"MT-ND1","A-T","274","3","R-R","0.000%","0","1"4129,"MT-ND1","A-G","275","1","T-A","0.184%","109","9"4129,"MT-ND1","A-T","275","1","T-S","0.000%","0","1"4130,"MT-ND1","C-T","275","2","T-M","0.002%","1","1"4131,"MT-ND1","A-C","275","3","T-T","0.000%","0","1"4131,"MT-ND1","A-G","275","3","T-T","0.109%","65","4"4131,"MT-ND1","A-T","275","3","T-T","0.000%","0","1"4132,"MT-ND1","G-A","276","1","A-T","0.013%","8","1"4132,"MT-ND1","G-T","276","1","A-S","0.000%","0","1"4134,"MT-ND1","A-C","276","3","A-A","0.005%","3","1"4134,"MT-ND1","A-G","276","3","A-A","0.008%","5","1"4134,"MT-ND1","A-T","276","3","A-A","0.000%","0","1"4135,"MT-ND1","T-A","277","1","Y-N","0.000%","0","1"4135,"MT-ND1","T-C","277","1","Y-H","0.042%","25","1"4136,"MT-ND1","A-C","277","2","Y-S","0.003%","2","1"4136,"MT-ND1","A-G","277","2","Y-C","0.118%","70","4"4137,"MT-ND1","C-T","277","3","Y-Y","0.066%","39","3"4138,"MT-ND1","C-T","278","1","P-S","0.002%","1","1"4140,"MT-ND1","C-T","278","3","P-P","0.128%","76","14"4143,"MT-ND1","A-C","279","3","R-R","0.003%","2","1"4143,"MT-ND1","A-G","279","3","R-R","0.003%","2","2"4144,"MT-ND1","T-C","280","1","F-L","0.000%","0","1"4144,"MT-ND1","T-G","280","1","F-V","0.000%","0","1"4146,"MT-ND1","C-T","280","3","F-F","0.000%","0","1"4148,"MT-ND1","G-A","281","2","R-H","0.002%","1","1"4149,"MT-ND1","C-T","281","3","R-R","0.002%","1","1"4151,"MT-ND1","A-G","282","2","Y-C","0.002%","1","1"4152,"MT-ND1","C-T","282","3","Y-Y","0.002%","1","1"4153,"MT-ND1","G-A","283","1","D-N","0.000%","0","1"4155,"MT-ND1","C-A","283","3","D-E","0.000%","0","1"4155,"MT-ND1","C-T","283","3","D-D","0.007%","4","1"4158,"MT-ND1","A-G","284","3","Q-Q","0.236% ","140","4"4159,"MT-ND1","C-T","285","1","L-F","0.002%","1","1"4161,"MT-ND1","C-A","285","3","L-L","0.000%","0","1"4161,"MT-ND1","C-T","285","3","L-L","0.040%","24","5"4164,"MT-ND1","A-G","286","3","M-M","1.258% ","747","17"4165,"MT-ND1","C-G","287","1","H-D","0.000%","0","1"4165,"MT-ND1","C-T","287","1","H-Y","0.002%","1","1"4166,"MT-ND1","A-G","287","2","H-R","0.003%","2","1"4167,"MT-ND1","C-G","287","3","H-Q","0.002%","1","1"4167,"MT-ND1","C-T","287","3","H-H","0.037%","22","2"4168,"MT-ND1","C-T","288","1","L-F","0.002%","1","1"4169,"MT-ND1","T-C","288","2","L-P","0.000%","0","7"4170,"MT-ND1","C-A","288","3","L-L","0.002%","1","1"4170,"MT-ND1","C-T","288","3","L-L","0.189%","112","4"4171,"MT-ND1","C-T","289","1","L-L","0.062%","37","3"4172,"MT-ND1","T-A","289","2","L-Q","0.057%","34","4"4173,"MT-ND1","A-G","289","3","L-L","0.012%","7","1"4176,"MT-ND1","A-G","290","3","W-W","0.007%","4","1"4178,"MT-ND1","A-T","291","2","K-M","0.000%","0","1"4179,"MT-ND1","A-G","291","3","K-K","0.002%","1","1"4180,"MT-ND1","A-G","292","1","N-D","0.017%","10","2"4181,"MT-ND1","A-AA","292","2","frameshift","0.002%","1","1"4181,"MT-ND1","A-G","292","2","N-S","0.012%","7","3"4182,"MT-ND1","C-T","292","3","N-N","0.024%","14","1"4184,"MT-ND1","T-G","293","2","F-C","0.000%","0","1"4185,"MT-ND1","C-T","293","3","F-F","0.019%","11","3"4186,"MT-ND1","C-T","294","1","L-L","0.008%","5","1"4188,"MT-ND1","A-G","294","3","L-L","0.423% ","251","3"4188,"MT-ND1","A-T","294","3","L-L","0.000%","0","1"4189,"MT-ND1","C-T","295","1","P-S","0.003%","2","1"4190,"MT-ND1","C-T","295","2","P-L","0.000%","0","1"4191,"MT-ND1","A-C","295","3","P-P","0.008%","5","1"4191,"MT-ND1","A-G","295","3","P-P","0.010%","6","2"4191,"MT-ND1","A-T","295","3","P-P","0.002%","1","1"4192,"MT-ND1","C-A","296","1","L-I","0.002%","1","1"4193,"MT-ND1","T-C","296","2","L-P","0.000%","0","1"4194,"MT-ND1","C-A","296","3","L-L","0.000%","0","1"4194,"MT-ND1","C-T","296","3","L-L","0.040%","24","1"4197,"MT-ND1","C-T","297","3","T-T","0.357%","212","1"4198,"MT-ND1","C-T","298","1","L-L","0.047%","28","1"4200,"MT-ND1","A-C","298","3","L-L","0.000%","0","1"4200,"MT-ND1","A-G","298","3","L-L","0.020%","12","3"4200,"MT-ND1","A-T","298","3","L-L","0.040%","24","6"4201,"MT-ND1","G-A","299","1","A-T","0.000%","0","1"4202,"MT-ND1","C-T","299","2","A-V","0.002%","1","1"4203,"MT-ND1","A-C","299","3","A-A","0.002%","1","1"4203,"MT-ND1","A-G","299","3","A-A","0.328%","195","5"4204,"MT-ND1","T-A","300","1","L-M","0.000%","0","1"4204,"MT-ND1","T-C","300","1","L-L","0.133%","79","2"4205,"MT-ND1","T-C","300","2","L-S","0.025%","15","1"4206,"MT-ND1","A-C","300","3","L-F","0.002%","1","1"4206,"MT-ND1","A-G","300","3","L-L","0.027%","16","1"4206,"MT-ND1","A-T","300","3","L-F","0.002%","1","1"4208,"MT-ND1","T-G","301","2","L-R","0.002%","1","1"4209,"MT-ND1","T-C","301","3","L-L","0.030%","18","2"4211,"MT-ND1","T-C","302","2","M-T","0.000%","0","1"4212,"MT-ND1","A-G","302","3","M-M","0.066%","39","2"4213,"MT-ND1","T-G","303","1","W-G","0.000%","0","1"4215,"MT-ND1","A-G","303","3","W-W","0.008%","5","0"4216,"MT-ND1","T-C","304","1","Y-H","10.236% ","6079","90"4218,"MT-ND1","T-C","304","3","Y-Y","